Transcript asmbl_54237

Sequence
Transcript Sequence for observation asmbl_54237 of TGE0006011:
CTCCCGTCTTCCTCTCTCTACCTCAGCAGAAGCCGCCGGGGTCTTCTTGGAGTCTAACTGTTGTAGACGCCCACCCGCTGTGCAGTTGCGATGCCGCGTGGTAGCCGAAGCCGCACCTCCCGCATGGCCCCGCCGTCCAGCCGGGCACCTCAGATGAGAGCTGCGCCCAGACCAGCGCCAGCAGCCCAGCTGCCAGCAGCAGCTCCACCATCTGCTGTTGGCTCACCTGCTGCTGCACCCCGGCAGCCAGGTCTGATGGCCCAGATGGCAACTACTGCAGCTGGTGTAGCTGTGGGCTCTGCTGTTGGCCACACGCTAGGTCATGCCATCACTGGGGGCTTCGGTGGAAGTAACACTGAGCCCTCAAGGCCTGACATCACTTACCAGGAGCCACAGGGAACCCAGCCGGCATACCAGCAGCAGCAGCAGTTTGGCCCATGCCACTATGAGATGAAACAGTTTTTGGAGTGTGCCCAGAACCAGGGTGACCTTAAGCTTTGTGAGGGTTTCAGCGAGGTGCTGAAACAGTGCAGATTTGCAAATGGATTAGCCTAATCAAGAAGTTCAAATTGAAGACATGGAAAATCATCTCTCACGACCAAGTTAATTTAGTATAAAAATATAATGGATAGTGAAAGTATAAAGTGTAAAACCACCAGTTAAACCTCTCTATTATTAATAGCTTCCTTGCCTCAGAATTGCAGTGGAAGAGAGTGTTCATACTGTATAGTTCATTGAGATGGTATTGAGTTTGGGGTTGGGCAGATGGTTTTGTGGGCTCCTTAAACCAGGTTTTGTGATGTTATTTGTGAATCGATTAGAATAAAGTGATTTTCTTCCAAAA