Transcript asmbl_53205

Sequence
Transcript Sequence for observation asmbl_53205 of TGE0027987:
GGGATGCGTGCGCCTGGCTGTCGTAGACACCCAGTGGTGAGCAGAACACGTGTGCTTATCCCGGTGGCGATAGTGGGACCTGAGGCTCTTCATCTTCATCTGCGTTCTGGTACATGGTCACCAGGGCATTCTCATTCCACCCATCGCCTTGGAGCCACATCTCGGAGACACCTGGTAGCTTCCTCGATGTTAGGGGTAGAGCCTCTGTAGGGAGCTAACTGCCGTCCTTGCCCTCTCTTGTCCCCCTCTCGAATGCTGTCAGATACCATTCTTTGCTGGAACTGGGTGAGAAGCGGAAAGGCATGTTGGAGAAGAGTTGTAAGAAGTTTATGTTGTTCCGTGAAGCGAACGAGCTCCAGCAGTGGATCAACGAGAAGGAAGCGGCTCTGACGAGTGAAGAGGTCGGCGCGGACTTGGAGCAGGTCGAAGTGCTGCAGAAGAAGTTCGACGACTTCCAGAAGGATCTGAAGGCCAATGAGTCACGGCTGAAAGACATCAACAAGGTGGCTGAAGACCTGGAGTCTGAAGGTCTCATGGCAGAGGAGGTGCAGGCAGTCCAGCAGCAGGAGGTGTATGGCATGATGCCAAGGGATGACACCGATTCCAAGACAGCCTCCCCCTGGAAGTCTGCTCGCCTGATGGTTCACACCGTGGCCACCTTTAATTCCATCAAGGAGCTGAATGAGCGTTGGCGGTCCCTGCAGCAGCTGGCCGAGGAGCGGAGCCAGCTCCTGGGCAGCGCCCATGAGGTGCAGAGGTTCCACAGAGATGCTGATGAAACCAAAGAGTGGATCGAAGAGAAGAATCAGGCTCTAAACACAGACAATTACGGTCACGACCTGGCCAGTGTCCAAGCCCTGCAGCGCAAACACGAGGGTTTTGAGAGAGACCTCGCGGCTCTCGGCGACAAGGTAAATTCCCTCGGGGAAACAGCTGAGCGCCTGATCCAGTCTCACCCCGAGTCGGCGGAGGACCTCCAAGAGAAGTGCACGGAGTTAAACCAGGCGTGGAGCAGCCTGGGGAAGCGTGCAGACCAGCGCAAAGCCAAGCTGGGCGACTCGCACGACCTGCAGCGCTTCCTCAGCGACTTCCGGGACCTCATGTCTTGGATCAACGGAATACGTGGGTTGGTGTCCTCAGACGAGCTGGCCAGGGATGTCACTGGAGCCGAAGCTTTGCTGGAACGACACCAGGAACACCGGACAGAAATTGATGCCAGGGCTGGCACTTTCCAGGCATTTGAGCAGTTTGGGCAGCAGCTGTTGGCTCATGGGCACTATGCCAGCCCAGAGATCAAGGAGAAACTAGACATTCTGGATCAGGAGCGTACAGACTTGGAGAAGGCCTGGGTGCAGCGCAGGATGATGCTGGATCAGTGCCTTGAACTGCAGCTGTTTCATCGGGACTGCGAGCAGGCGGAGAACTGGATGGCTGCCCGGGAGGCCTTCCTGAATACCGAAGACAAAGGGGATTCGCTGGACAGTGTGGAGGCCCTGATCAAAAAACACGAGGACTTCGACAAAGCCATTAACGTCCAGGAGGAAAAGATTGCTGCTCTGCAGTCCTTTGCCGACCAACTCATCGCCGCCGGCCACTATGCCAAAGGCGACATTGCTAGCCGGCGCAATGAGGTTTTGGACAGATGGCGACGTCTAAAAGCCCAGATGATTGAGAAGAGGTCAAAGCTGGGAGAATCGCAAACCCTGCAGCAGTTCAGCCGGGACGTGGATGAGATTGAGGCTTGGATCAGCGAAAAATTACAGACCGCGAGCGATGAGTCATATAAGGATCCCACCAACATCCAGAGCAAGCACCAGAAGCACCAGGCCTTCGAAGCAGAGCTACACGCCAACGCTGACCGGATCCGCGGCGTCATTGACACCGGCAACTCCCTGATTGAACGTGGGGCCTGTGCCGGCAGCGAGGATGCCGTCAAGGCCCGGCTGGCTGCCTTGGCCGACCAGTGGCAATTCCTGGTGCAAAAGTCCGCTGAAAAGAGCCAGAAACTGAAAGAAGCCAATAAGCAGCAGAACTTCAACACGGGGATCAAGGACTTCGACTTCTGGCTCTCTGAGGTGGAAGCCCTTCTGGCATCTGAGGATTACGGCAAAGATCTTGCTTCTGTGAACAACTTGCTGAAAAAACATCAGCTACTGGAGGCGGATATATCTGCCCACGAGGATCGCCTGAAGGACCTGAACGGCCAGGCAGACAGCCTGATGACCAGCAGTGCCTTCGACACCTCCCGAGTGAAAGACAAGCGGGACACCATCAACGGTCGTTTCCAGAAGATCAAGAGCATGGCGGCCTCCCGGCGAGCCAAGCTGAATGAATCCCATCGCCTGCACCAGTTCTTCCGGGACATGGATGACGAGGAGTCCTGGATCAAGGAGAAGAAGCTGCTGGTGAGCTCTGAGGACTATGGCCGAGACCTAACAGGTGTGCAGAACTTGAGGAAGAAGCACAAACGGCTGGAGGCAGAGCTGGCCGCGCACGAGCCTGCGATTCAGGGTGTCCTGGACACTGGAAAGAAGCTGTCTGACGACAACACCATCGGGAAGGAGGAGATCCAGCAGCGTCTGGCGCAGTTTGTGGAGCACTGGAAAGAGCTGAAGCAGCTGGCGGCGGCTCGGGGCCAGCGGCTAGAAGAGTCCTTGGAATATCAGCAGTTTGTAGCCAACGTGGAAGAGGAGGAAGCCTGGATCAATGAGAAAATGACGCTGGTGGCCAGTGAAGATTATGGGGACACTCTGGCTGCTATCCAGGGCTTACTGAAGAAACACGAAGCTTTTGAGACGGACTTCACCGTCCACAAGGACCGCGTGAATGACGTCTGCACCAACGGACAAGACCTCGTCAAGAAGAACAATCACCACGAGGAGAACATCTCCTCAAAGATGAAGGGCTTGAATGGGAAAGTGTCTGACTTGGAGAAGGCCGCGGCGCAGAGGAAGGCGAAGCTCGACGAGAACTCGGCCTTCCTCCAGTTCAACTGGAAAGCCGACGTGGTGGAATCCTGGATCGGTGAAAAGGAGAACAGCTTGAAGACAGATGACTATGGCCGCGATCTCTCTTCTGTCCAAACTCTCCTTACCAAACAGGAAACCTTTGATGCTGGCCTGCAGGCCTTCCAGCAGGAGGGCATTGCCAACATCACTGCCCTCAAGGATCAGCTGCTGGCCGCCAAGCACATTCAGTCAAAGGCCATCGAGGCCCGGCACGCCGCCCTCATGAAGAGGTGGAGCCAGCTTCTGGCCAACTCAGCCACCCGGAAGAAGAAGCTGCTGGAAGCTCAGAGTCACTTCCGCAAGGTAGAGGACCTCTTCCTGACCTTTGCCAAAAAGGCTTCTGCCTTCAACAGCTGGTTTGAAAACGCAGAGGAGGATCTGACAGACCCAGTGCGCTGCAACTCCCTGGAGGAGATCAAAGCCCTGCGAGAGGCCCATGACGCCTTCCGCTCCTCGCTCAGCTCCGCCCAGGCCGACTTCAACCAGCTGGCCGAGCTGGACCGCCAGATCAAGAGCTTCCGCGTGGCCTCCAACCCCTACACCTGGTTCACCATGGAGGCCTTGGAGGAGACCTGGCGGAACCTGCAGAAGATCATCAAGGAAAGGGAGCTGGAGCTGCAGAAGGAGCAGCGCCGGCAGGAGGAGAATGACAAGCTGCGCCAGGAGTTCGCCCAGCACGCCAACGCATTCCACCAGTGGATCCAGGAGACCAGGTCCTGCATGGTGGAAGAGTCCGGGACCCTCGAATCCCAGCTCGAAGCTACCAAA