Transcript asmbl_53124

Sequence
Transcript Sequence for observation asmbl_53124 of TGE0013196:
CGGTCTCGGCCCGCGCGGTCCAGACGTACTTGGCTCGCCTGCGTGTGGCCGCGGTTGCGCGTCGACCATGGCGGTTACCGACGGATTGCTTCTCCACCTTTCCGAGCCCCCAGCCGCCGCCGCCGCCTTCAGGACGTTCTCCAGACCCCGCGTGGCCCAGGCGAGGCGGCAAGCACAGGCCACCAAAAGGAAGTACCAAGCATCCAGCGAGGTTCCCTCAGCGAAGCGGAGGAGCAGGGCATCCTCTCTGCCCGCTAAGAAAACCACCGCGGAAGGAGTGCAGAGGGCTCCCGAGGGGAGGGCGCAGACGGCGTCTTCCCCGCGGAGGTCTTCGGCCGGCGGCAGGGGTAGGAACCAAGAGCAGAAGCCATGCGTTAAGACCTCCTCGTTGTTTAAAAACAACCCCGAGATTCCAGAACTCCACAGACCCGTCGTACAGAAGGTGCAAGAAAAGGTGTTCTCTTCAGGTGCTTTTCATGACCTGGACCTCCACCCTCATTTGATTTCCACAATAAACACAGTCTTAAACATGTTCAACATGACCAGTGTTCAGATGCACAGCATTCCCGTGCTGCTGGAAGGCAGAGATGCCCTCGTGAGATCGCAGACCGGCTCAGGTAAAACTCTTGCCTATTGCATCCCTGTGGTCCAGTCCCTTCAAGCAATGAAAACGAAAATACAGCGCAGTGACGGCCCCTATGCTCTGGTGCTGGTGCCCACGAGAGAGCTGGCTCTACAAAGCTTTGACATCTTCCAGAAACTTCTCAAGCCGTTCACTTGGATTGTGCCCGGAGTGCTCATGGGAGGCGAGAAGAGAAAATCGGAAAAAGCCAGACTCCGCAAGGGAATAAATATCCTTATCTCAACTCCGGGGCGACTGGTGGATCACATCAAATCCACAAAGAACATTCATTTTAGCCGGGTACAGTGGCTGATTGTGGATGAAGCCGACAGAATCTTGGATTTGGGTTTTGAGAAGGATATCACAGTGATACTCAATGCAGTCAATGCCGAGTGTCAGAAGCGACAGAACGTCTTGCTGTCGGCGACACTCACGGAAGGGGTGGCCCAGCTCGCCGATATCAGTTTACTCAACCCAGTCAGTATTTCTGTCCTGGAAGAAGGCTACGGACAGGCTAACCCACAGGGCGGAGGAGCTCTTGAAGTCTCCGCTCCACAAACCAGCGACGAGTTGGACAGCTTCGCGATACCGGAGGGTCTCGATCAGCACGTGACCTTGGTTCCCAGCAAACTGAGGCTGGTCTCCCTGGCGGCCTTCATCCTGCAGAAGTGCGCGTTCGCAGCCGACCAGAAGATGATCGTCTTTTTCCCGAGCTGCGAGCTGGTGGAGTTCCACTACACGCTCTTCGTCCAGACCCTGCTGCCCCGCCCGGGAGCCCCGGCCGCGGCGCCCTTACCATCCGGCTCCACGCAGTTGAAGTTCCTGCGGCTGCACGGGGGTCTGGAGCAGGAGGACAGAATAGCCGTGTTTCAAGAATTCTCCCATTCCAGAACGGGCGTTCTCCTTTGCACGGACGTTGCGGCTCGGGGCTTAGATCTCCCTCAAGTCACGTGGATTGTTCAGTACAACGCTCCGTCTTCGCCGGCTGAGTACGTCCACCGGGTTGGGAGAACTGCCCGCATTGGCTGCCGGGGGAGCAGCCTGCTCATTTTGGCTCCTTCGGAGGCAGAATATGTCAACTCGTTGGCTTCTCACAAAATCAATGTTTCCGAGATTAAGATGGAAGATATTTTGTCTGTTCTGACAAGGGATGATTGTTTTCCGGGGAAGCAGTGGGGAAAGCAGAAACCCCGTGCCTTGAGCCCCCAGGGGATCCGAGAGCGAGCCACGGTCTTGCAGACGGTGTTTGAAGATTACGTGCACTCCAGTGAGCAGACGGTCTCCTGGGCAAAGAAAGCCCTGCAGTCCTTCATCCGTGCCTACACCACCTACCCCCGAGAGCTGAAGCACATCTTCCACGTTCGGTTGCTGCACCTTGGGCACGTGGCTAAGAGCTTCGGGCTAAGAGATGCGCCCCAGAATCTTAGCGTCTCGGCCGTAAAAAAGAAAAAAGCCGCCCCGAAAAGGCCTGACCTTCGGAAGAAGACCCAGAGTAAGCAGCGCCTTGCTGAAATCTTGCGTTCCGAATACGCAAGCGGGATGGAGGCTGGCATGGCCAAGGTCAGAAAGCAGAGCAAACAGGCCGACCAGGCAGCCGGCCGAGCGGCACGTCCGAGACCCGAGCCCGGCCTGGGCCGTGGGAAAAAGCAAAAGAAAAAACGCTCTCCGTGAAGGAGAGAAACCCAGAAAGGCTTACGAGGGACGAGACTCCCCAGAAAGTTGCTCTAAACTCTTCCTCCCCAGGACCGGGCCTGTGGCCCTGGTGGCACTGGATCGATGTCCCGCTCTCTTTTCAGAGGAGCCTTGGGACACGTACCAGTGCCACCTGTCCCTGATGACGGGCGTCCCTGCCACAGAGCGGCCACGGCCCCGTCTCCCACGGGGAGGGGTCAGCGGGGCAGGGAGTCAGTGGTTAGCCTGTGTCTTACAGCAGACACCTCACATCTTGTGTTCATTCTGTCAGCGCCCACACCTGCTTCACCCGTAGATCAGATGGTGCCCCCACGACTTAGTGCCTAAGCCTTGTCCTTACGTCAGCCAGGAGAGGCTGCGACCTGCCTGGTGACACGATCTGAAGAAATGTCTGTGTTCCTTTCTCCCGCCCCATCAGCGCCCATATGGGCGTGAATTTTGTAAAGTAAGATATCAAACTCCGGACTTCAATTTGTCAAAGAAGAAAATATTTATCAGATCACCTTCTCGATGTCTAAATGCTCGTGAGAGAGGATGGAAGGGGTTCGGGTGTGAGTCCCCGCGGTCAGCCCTCCTGGTTCCCGTCCGGGCTGCCCCCACCTCCAGACCACATGCGCAGGCATTGCTGGTGCCCCCCACATCCACGGAAAACTGATGCTCAGGACTAATTGACTTGCTGTCGCCGTTTTATCATTCGCCTTTGAAGTCAAAGGCTCCAGTGTCCTGAGCTTTTTCTCTCATGGAATCCGGTCCCCTCCAAGAAAGGCCTGAGGTCTTTGTACTGTGGCCCAGGCCACAGCTGCCCCGCCCCCATTGTGTTTCCTGGGAAGTTTGAAAGGGACCCCCAGGGCGTATTGATTTCCCAATAAATGTAAGATTTGGACACGGGTGACCGCAGAGGGTGCG