Transcript asmbl_18514

Sequence
Transcript Sequence for observation asmbl_18514 of TGE0004009:
CGCAGATTCCTCGGGATGGCAACCAACATGGAGGCGCAGAGCGCCGGAGCCGTGGACGGCTTCACCCCGGTCACCCGCAAGGGTGGCCGGCGGGCGAAGAAACGGCAGGCTGAGGAGCTCTCCGCGGCAGGGGAGGACGAGGACGCGGGCCGCATGGATACCCAGGAGGCTCGGCCCGCAAAGAGGCCGGTCTTCCCGCCCCTCTCCCGGGACGGGTTTCTGGATGGGAAAGAAGAAACAAGGAAAATTTCAGTCCCAGCTAACAGATACACACCATTAAAAGAGAACTGGATGAAGATATTTACTCCCATTGTAGAACATTTGGGACTTCAGATACGCTTTAACTTGAAATCGAGAAATGTAGAAATCAGGACTTGTAAAGACACCAAGGATGTTACCGCTCTGACAAAAGCAGCTGATTTTGTGAAAGCCTTTATTCTCGGGTTTCAGGTAGAGGATGCACTTGCCCTCATTAGGTTGGATGACCTCTTCTTAGAGTCTTTTGAAATCACAGATGTGAAGCCGCTAAAGGGAGACCACCTGTCGAGGGCAATAGGAAGAATCGCTGGCAAAGGAGGAAAAACCAAATTTACCATAGAGAATGTGACACGGACGCGGATAGTTTTGGCTGATGTGAAAGTTCACATCCTTGGCTCTTTCCAAAACATCAAGATGGCGAGAACTGCCATCTGCAACCTCATCCTGGGAAATCCTCCATCAAAGGTTTATGGCAATATTCGAGCCGTGGCTAGCAGAGCAGCAGATCGATTCTAATTTCAAATCAGAGACTTTTTATCTTGCCTTCGGACTAGAGAAAAAGACTTTATAAGTGGTAACAAGAAACCATGTGAAAAAACTGTCACTTAAGCTTCAGTCCCTTCTTCAGTTCTCAGCCAGAAGTATAAACAGAAAAGTTTGATAGTATTCACACTCAATAGCTTTTAGGATAATTTTAATGTCAGAATTTAGTACCATTATATTTAAACATTAATTATAATTTATCATTTCGTACATTTTAAATCACATGTAGATTTGCAGTTTCTAATTCTCTCATTTAGAGAGAAACTTATCGTTTAAACAGTTGTCTATGAATTTTTAAGTTTTTTGCTTTATAAATTTATAAACATTTCTTCTCTGTGGGTTGTAATTAAAGTACTGTCTCAGAAAACCTCTCCAAATCATGACCCTTAACACCGGGTGGTGTATGACTGTTTCAGAATCAGGTCATAAGCAGCAGTTTGGCTGCGCTGTGTGAACTAAAAGTCCCAATATTTGTACCTGTTTTGCAGTTTGTAAAATTAAAGACCTGTATCACGAGGTTGACATTTTGTGTGTTATTTTCATTTAAGTGTGTAATGAAAGTAGACCTTTCCAATGTTGGGTATATTTCTTCTAGGTATTAAAAGTGAAATGTGGTAAAATGTTTTTACTCCTACGAAAACTACTATGTTCTCCAAATGTAATGGATTGTTTTAACTAGTGTCTGCCTATTTAAATATTATGATTCTGTTTATGCATTTTTTTAAATGGAATGATACCACATTCGCTTGTACATCTCTAAAACCGTTGACGAAAACTTTTAACTTTACTGATGGGAGTATTAAAAAGTTCATGTAAGGACTAGAAAAAGTATTCTATTAAGCTTCTATTTCTTTTACATCAGTTACATGTGCCACTGCCTCAAACTGGTTTGTACTTTGTATAGGATTGGAGATACATACTACAGTGGTAATTCAATAGGAAACTGCTGGGAGCATTTCCCACTCAAAACATTTTTTTTGTCCTTTGGCAGCACAGCAGCGTGTAGAGTATGGTGTATGATGGTATCAAATCTTTTCATATCTTTTTGAAAA