Transcript asmbl_52888

Sequence
Transcript Sequence for observation asmbl_52888 of TGE0005878:
GGCAGGGCACACACTGGCCCCGGTGCCCACCCGCACCCCACCCCCAGAGCGCTGACTCGGCTCCCCGGACCTCGGCAGGATGGAAGAGAAGCTGAAGAAAACCAAGATCATCTTTGTGGTGGGCGGGCCCGGCTCGGGGAAGGGCACCCAGTGTGAGAAGATTGTCCAGAAGTACGGCTATACTCACCTTTCCACCGGGGACCTCCTGCGGGCCGAGGTCAGCTCGGGCTCGGCCAGGGGCAAGATGCTGTCGGAAATCATGGAGAAGGGGCAGCTGGTGCCGCTGGAGACAGTGTTGGACATGCTCCGAGATGCCATGGTAGCCAAGGTAGACATTTCCAAAGGCTTCCTGATCGATGGCTACCCTCGGGAGGTGCAACAGGGGGAAGAGTTTGAGCAGAGGATCGGACAGCCCACGCTGCTGCTGTATGTGGACGCAGGCCCCGAGACCATGACCAAGCGGCTCCTGAAGCGGGGAGAGACCAGCGGGCGTGTGGACGACAACGAGGAGACCATCAAGAAGCGGCTGGACACCTACTACAAGGCCACAGAACCTGTCATTGCCTTCTATGAGAAACGTGGCATCGTGCGTAAGGTCAATGCCGAAGGCTCCGTGGACAGTGTCTTCTCCCAGGTCTGCACCCACCTAGACGCCCTCAAGTAGCAGCGCCGGAGCCCCTTCCCCAGCTCAGAGCCCCACCCCACCCCTGTCCTGACTCAAGAACCCTGGCCTGAGCTCAGCGCCTCCGCCCTGCCCGCTGGAGCACAGACAGAGGAAGCCACTTTATCCTGTTTTCATGGACAGCTGAGCACTAAAGGAATTTCCGAGGACATTCGGTTTTACTCCTTTTTCTTTGCTTCCATCGGGGTTGATTCATGTGGGGTGGCCGCCCTGGCCTCGAGCCCCTCACCCTCCCCATTCCTCCTCAGGTCCCTCAGCCCACCTTGGCCGGCCGCCCCTCCCCAGTAGAAGGTCCCCTTCCTCACACAGGGTGTGCCGAGCTCAGACTGGGCCAGGCCTGGGGAGCCAGGGTCCTTGCTTTCTGGGACTCGTGGTCAGACAGAGCTGGGCCCTGGCCTGGATTCCTCTGCATTCTTGCTGTGTGGACTTGGCCCTGACCCCTCCTGTCTCTGAGCCCGTTTTCTGTGCCTAACCTCCTCTGGGGACTGAGCCATAGCAGGCAACAAGGTCATGGGCAGCGTGGGGCTCCCTGGTGGTGGGGGCAGCACACGTCGGCAAGCCAGGTGGGCAGGAAATTGGCCACCTTGGTACAAGAAGCCCCGAGGGTCTGAAAAGGACATCAAGAGTGAATGGGGGGAAGGGGTCAAGGTCAGGAGAGCCTCCCCGAGGAGGTGAGACCTGAAAGTCTTCCCACCATGTGGCCCTGGACAAGTCACAACCTGTCTTTCCTAAGGCCATTTCAAAATTTAAATTAGGCTCAGTGCCCAGCCCCCCCAGGTCAGGAAGAGAACTCACTAAACAGAGTGCGTAGGCTGTCAGGTACCGAGGCCCGTGGGAGCCAGAGGCCAGAGCAGCCTTGGGGATGTGCCAGGCTGGGGTGCTCTGGGGAGGCCCCAGAATCCCCTGGGGAGAACCATCTCTTCTTTTCTGTTCTTTCACTCTTTGACCTTGTCACGGAGAAAGGCTCCGTTTGGTGCTCACGTGTCCTAAACACCCACCCCAGCCCCAGCTGGCTCTCTTTAAAGCCAAGACAGCCCTGAGCGGGCCACACCTGGCTGGAACGGAACCCCATGTGGGCTGATTGTGCCTGTCATGTGTCCCTTCTATTTATAGCAAGC