Transcript asmbl_52865

Sequence
Transcript Sequence for observation asmbl_52865 of TGE0005876:
GACGCTGGCCCAGACATCAGAGACCTACTGAATTCAGGATTTCGTGAGTGAGAACTGTAAGCGCTGCGGCCTGTCTTTCGGATCTGCCCTTCGTTTTGTCCGCTGCGCCTCCTGACCGCTGGCCCTGTCTCCCTCAGGTCAGTAATCTCGGTGCGTTCCCGTCCTTCGGCCTGTGGCTGGATTGCTTGCGACGTCCTATCTACCTGCCTGCTGACTGACTGGCCGACAGCTCCGGCAAGATGAAGCTCTCCCTGGTGGCTGCGGTGCTGCTGCTGCTCGGCGCGGCGCGGGCCGAGGAGGAGGACAAGAAAGAGGACGTGGGCACGGTGGTCGGCATCGACCTGGGGACCACCTACTCCTGCGTCGGGGTGTTCAAGAATGGCCGCGTGGAGATCATCGCCAACGATCAGGGCAACCGCATCACGCCGTCTTATGTGGCCTTCACTCCCGAAGGGGAGCGTCTCATCGGGGATGCAGCCAAGAACCAGCTCACGTCCAACCCTGAGAATACGGTCTTCGACGCCAAGCGGCTCATTGGCCGTACTTGGAACGACCCGTCTGTGCAGCAGGACATCAAGTTTTTGCCTTTCAAGGTGGTTGAAAAGAAAACTAAACCATACATTCAAGTTGATATTGGAGGTGGCCAAACAAAGACATTTGCTCCTGAGGAAATTTCCGCCATGGTTCTCACTAAAATGAAGGAAACTGCTGAGGCTTATTTGGGAAAGAAGGTTACTCATGCAGTTGTTACTGTACCGGCCTATTTCAATGATGCCCAACGCCAGGCAACCAAAGATGCTGGAACTATTGCTGGATTGAATGTTATGAGAATCATCAATGAGCCTACAGCAGCTGCTATTGCTTATGGCCTAGATAAGAGAGAAGGGGAGAAGAACATCTTGGTGTTCGACCTGGGTGGTGGAACCTTCGATGTGTCTCTTCTCACCATTGATAATGGTGTCTTCGAAGTTGTGGCTACTAATGGAGATACCCATCTGGGTGGAGAAGACTTTGACCAGCGTGTCATGGAACACTTCATCAAGCTCTACAAAAAGAAGACTGGCAAAGATGTTAGGAAAGACAACAGAGCTGTGCAGAAACTCCGGCGGGAGGTAGAAAAGGCCAAACGGGCCCTGTCTTCTCAACATCAAGCAAGAATTGAAATTGAGTCCTTCTTTGAAGGAGAAGACTTCTCTGAGACCTTGACTCGAGCCAAATTTGAAGAACTAAACATGGACCTGTTCCGTTCTACCATGAAGCCTGTCCAGAAAGTGCTGGAAGATTCTGATTTGAAGAAATCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCTACTCGAATCCCAAAGATCCAACAACTGGTTAAAGAGTTCTTCAATGGCAAGGAGCCATCCCGTGGCATAAACCCAGATGAGGCTGTGGCATATGGTGCTGCTGTCCAGGCTGGTGTACTGTCTGGTGATCAAGATACAGGTGATCTGGTACTGCTTGACGTATGTCCGCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCCAGGAACACTGTGGTGCCCACCAAGAAGTCACAGATCTTTTCTACAGCTTCCGATAATCAACCAACTGTTACAATCAAAGTTTATGAAGGTGAACGACCCCTGACAAAAGACAATCATCTTCTGGGAACTTTTGATCTGACTGGAATCCCTCCTGCTCCCCGTGGAGTCCCACAGATTGAAGTCACTTTTGAGATAGATGTGAATGGCATTCTTCGAGTGACAGCTGAAGACAAAGGTACAGGCAACAAAAATAAGATCACAATTACCAATGACCAAAATCGCCTGACACCCGAAGAGATTGAAAGGATGGTTAATGATGCTGAAAAGTTTGCAGAGGAAGATAAAAAGCTCAAGGAGCGCATTGATACTAGAAATGAATTAGAAAGTTATGCCTATTCTCTAAAGAATCAGATTGGAGATAAAGAAAAGCTGGGGGGCAAACTTTCCTCTGAAGATAAGGAGACCATGGAAAAAGCCGTAGAGGAAAAGATTGAATGGCTGGAAAGTCACCAAGATGCTGACATTGAAGATTTCAAAGCTAAAAAGAAGGAACTAGAAGAAATTGTTCAGCCAATTATCAGCAAACTCTATGGAAGTGCAGGCCCTCCCCCAACTGGAGATGAGGAACCAGTAGACAAAGATGAGTTGTAGACACTGCTCTGCTAGTGCTATGATGTTGTAAATACTGGACTCAGGAACTTTCGTTAGGAGAAAATTGAGAGAACTTAAGTCTCGAATGTAATTGGAATCTTCACCTTGGAGTGGAGTTGAAAATGCTATAGCCCAAGTGGCTGTTTACTGCTTTTCGTTAGCAGTTGCTCACATGTCCTGGGGTGGGGGGACAGGAAGAATTGGCTATCTTAAAAAGTGGGTAAAAAGGTTGGGTTACGGCATGTGTTCACCATGGAAAAATGTTCTATTTAACATTTGGGTCATGTGCATCTGGTGTAGGAACTTTATTTTCTACCGTAAGTGACATCAATAAATGTTTGTTATTT