Transcript asmbl_18501

Sequence
Transcript Sequence for observation asmbl_18501 of TGE0004007:
GCGGGATCGGCGGCGGTAGCAGCAGCATGGCCGCGCTCTACGGGGGTGTAGAGGGGGGAGGAACACGGTCCAAGGTCCTTTTACTCTCAGAGGATGGGCAGATCCTGGCAGAAGCAGATGGACTCAGCACAAACCACTGGCTGATCGGGACAGACAAGTGTGTGGAGAGGATCAATGAGATGGTGAACAGGGCCAAAAGGAAAGCAGGGGTGGACCCTCTGGTACCTCTACGAAGCTTGGGCCTATCTCTGAGTGGTGGGGACCAGGAGGATGCCGTGAGGATGCTGATGGAGGAGCTGAGGGACCGATTTCCCTACTTGAGTGAAAGCTACTTAATCACCACCGATGCCGCTGGCTCCATCGCCACAGCTACGCCAGATGGTGGGATCGTACTCATCTCTGGGACAGGCTCCAACTGCAGGCTCATCAACCCCGATGGTTCTGAGAGTGGCTGCGGCGGCTGGGGCCATATGATGGGGGACGAGGGTTCAGCCTACTGGATTGCACACCAAGCAGTGAAAATAGTGTTTGACTCCATCGACAACCTAGAGGCAGCTCCTCATGACATTGGCTACGTCAAGCAGGCCATGTTCAACTATTTCCAGGTGCCAGATCGGCTAGGCATCCTCACTCACCTGTATAGGGACTTTGATAAATGCAGGTTTGCTGGGTTTTGCCGGAAAATTGCAGAAGGTGCTCAGCAGGGAGATCCCCTTTCCCGTTATATCTTCAGGAAGGCTGGGGAGATGCTGGGCAGACACGTTGTAGCAGTATTGCCTGAGATTGACCCGGTCTTGTTCAAAGGAGAGATTGGTCTCCCCATCCTGTGTGTGGGCTCTGTGTGGAAGAGCTGGGAGCTGCTGAAGGAAGGTTTCCTATTAGCGCTGACCCAGGGCAGAGAGATCCAAGCTCAGAACTCCTTCTCGCTTCACCTTTTTTTTTATTCCTCTGCCCTGGGCGGGGCCAGCCTAGGGGCGAGGCACATCGGGCACCTCCTCCCCATGGACTACAGTCTCAATGCCATTGCCTTCTACTCTTATACCTTCTCCTAGGGGGCTGATCCTGGCTCTACCCACTCCTAAGCCCAGTGGACGTTGCGTGCTGGGAAGGAGGAGGCCTTTACTTCTTTCCCTTTTCTTACAAAGAGGAAAAACATATACAAGAAAATAAACGCACTTTACTCACTCCCCAATTGGATTGTGTTGTGAAGCACACTTGCTGTGTAAATGTACAGCGCACGTACCAGCAGGTACCCCAGAGGTCTCAGGAATGGTTTTAGC