Transcript asmbl_52021

Sequence
Transcript Sequence for observation asmbl_52021 of TGE0019377:
GTGAGTTTGAACACAGGTAAAGCTCTTTTGTCAGCTTTTGACTTTGACAGTGAAAACACTGGTGCTTGTTGACAGCCAGCGACCAGTGGTTTCGTTTCAGGGTGAACCCTTTGTCCCTGGTGGAGATCATTCTGCACGTGGTCAGACAGATGACTGGTGAGTCCCACGCTGTGTCCAAAGGACTGGGCCAAGTAATGAGAATGATCTTGCCTTCTGACGGAAAGTATTGCATTCTAACTTACATTTTTATTGTATTTTATGTTTTAAACCTAAAAGTTGTCCTGGTTGGTAGAAACCAGTCTGTAAAGATGCTTCGCTGGTATTCTGCTGACTCTGTCCTGCTTTCTTCTCCAGATCCTAACGTGGCTCTCACTTTTCTGGAAAAGACTCGTGAAAAGGTGAAAAGCAGCGACGAGGCAGTGATCCTGTGTAAGACGGCCATCGGGGCTCTCAAGTTAAACATCGGAGACCTGCAGGTTACAAAGGAGACGATCGAGGCTGTGGAGGACATGCTGCACAGCCTCCCTGGCGTGACGTCCGTTCACAGCCGTTTCTACGACCTGTCCAGCAAATACTACCAGACGGTCGGGAACCACGCGTCCTACTACAAAGACGCCCTGCGGTTCCTGGGCTGTGTCGACATCAGGGACCTGCCAGCGCCCGAGCAGCGAGAGCGAGCATTCACGCTGGGACTGGCGGGACTTCTTGGTGACGGAGTTTTTAACTTTGGAGAACTCCTCATGCACCCCGTACTGGAGTCTCTGAGGGGCACTGACCGGCAGTGGCTGATCGACACCCTCTACGCCTTCAACAGTGGCAACGTGGAGAGGTTCCAGACGCTGAAAGCCGCCTGGGGCCAGCAGCCTGACTTAGCGGCCAACGAAGCCCAGCTTCTGAGGAAAATTCAGCTGTTGTGCCTCATGGAGATGACTTTCACACGACCTGCCAATCACAGACAACTCACTTTTGAAGAAATTGCCAAAAGTGCTAAAATCAGTGTGAACGAGGTGGAGCTGCTGGTGATGAAGGCGCTCTCGGTGGGGCTGGTGAAAGGGAGCATCGACGAGGTGGACGGGCGGGTCCACATGACCTGGGTGCAGCCCCGCGTGCTGGATCTGCAGCAGATCGCGGGCATGCGGGACCGCCTGGGCTTCTGGTGCAGCGACGTGAAGAGCATGGAGATGCTGGTGGAGCACCAGGCCCACGACATCCTCACTTAGCGCCTGCCTGCGGAGCTGCCTCCTGGCTGACGAAGCTGGCGGCTGGGTCTTCATTTAAGTGGGGTGGGGTGGGGCGGGGATTCTGTTTGGAGTAGGGACTGTTCTTGCTGTGAAAACAGGACTGTCATTGATGGGGGCCTGGTCACATGGAGAAGCCTCCTTGGTGGGTGTCTCCTGTCACCTACACTGGGGAAGAGTCACCGCATCTTAGGTGGTGAGGCAAGCACGTGTGTGGGGACACCCGCTCTAAGGCTGGTTTCTGTCCATCCCCCTGCTGCATGAGCGCTCAGTTCTGTAATAAACGCCTTTGCTTTGT