Transcript asmbl_52018

Sequence
Transcript Sequence for observation asmbl_52018 of TGE0027941:
CGGATTTCTCAGTGGTGCCGCTGTCCGGGGATCTTTCTGCCGAAATGAAGGACGTTCCCGGCTTCCTGCAGCAGAGCCAGAGCTCCGGGCCCGGCCAGGCCGCCGTGTGGCACCGCCTGGAGGAGCTCTACACGAAGAAGTTGTGGCATCAGCTGACACTTCAGGTTCTTGATTTTGTGCAGGACCCGTGCTTTGCCCAAGGAGATGGTCTCATTAAGCTCTATGAGAACTTCATCAGTGAGTTTGAACACAGGGTGAACCCTTTGTCCCTGGTGGAGATCATTCTGCACGTGGTCAGACAGATGACTGATCCTAACGTGGCTCTCACTTTTCTGGAAAAGACTCGTGAAAAGGTGAAAAGCAGCGACGAGGCAGTGATCCTGTGTAAGACGGCCATCGGGGCTCTCAAGTTAAACATCGGAGACCTGCAGGTTACAAAGGAGACGATCGAGGCTGTGGAGGACATGCTGCACAGCCTCCCTGGCGTGACGTCCGTTCACAGCCGTTTCTACGACCTGTCCAGCAAATACTACCAGACGGTCGGGAACCACGCGTCCTACTACAAAGACGCCCTGCGGTTCCTGGGCTGTGTCGACATCAGGGACCTGCCAGCGCCCGAGCAGCGAGAGCGAGCATTCACGCTGGGACTGGCGGGACTTCTTGGTGACGGAGTTTTTAACTTTGGAGAACTCCTCATGCACCCCGTACTGGAGTCTCTGAGGGGCACTGACCGGCAGTGGCTGATCGACACCCTCTACGCCTTCAACAGTGGCAACGTGGAGAGGTTCCAGACGCTGAAAGCCGCCTGGGGCCAGCAGCCTGACTTAGCGGCCAACGAAGCCCAGCTTCTGAGGAAAATTCAGCTGTTGTGCCTCATGGAGGTGAGCGACCGCCGGGATGGTTTGTGGTGTGGGGCCCTGCAGATGAGCCTGTGCCCCCGCAGGCTCCCCAGCCTCTGGACACAGCAAATTGGTGGCATTGCTCCTGTCCTAACCCTTCTCCACCACCTCCCTTTTCCTCGGCCACCACGTGCTTTTTCAGTTTTGTATTTCGGTCTCGGCTCAGACGACCTCTCAGAGAGGCACCTGACCATCTGAGCTGAAGCGGCTGCCACTCCACTGGCTGTGGAATCCCTTGTCTTCCCCACTGGAATATAAGATTTCTGAGAAAAGAGACTTGGTGTTTCTGGTCACTGCGGTGTCCGCAGCTGCAAGTCCTTGTTCAGGACACAAATGATGACTGGTAGGAGCTGCTAGGGTACTTACTTTCGGCTAAGTACTGGAAGCTTGTTCTCGGTATGTGACTAGCGTTAAGAAAATTTTAGTGTGGT