Transcript asmbl_50585

Sequence
Transcript Sequence for observation asmbl_50585 of TGE0005759:
CAGGGCGCCTGCACGTCGGTCCGACTCCGGCCGTGGGTCCGCGGCGCGCGCTTGGCCCCACTCGCTGCCCCCGCAGTCCTGGCCCGGGGCGGACCAGTGGTCCCCGCGCTCTCGCGAGAAGTTCGCCGCCGTAGGGCGGTGGGATGCCAGAGCCCTCACGGGCCCTGGAGGGGCGGAAGATGGGGTGGTGCGCAGAAAAGCCGCAGCTTTTGCTGCTGGCTCTCATCCTCCAGCCCTGGACTCCCTGCCTAGGTGCAGACTCGGAGAAACCCTTCAGCATCCCCACAGATAAATTATTAGTCATAACTGTAGCAACAAAAGAAAGTGATGGATTCCATCGATTTATGCAGTCAGCCCAATACTTCAATTATACTGTGAAGGTCCTTGGTCAAGGAGAAGAGTGGAGAGGTGGTGATGGAATTAATAGTATTGGAGGTGGCCAGAAAGTCAGATTAATGAAAGAAGTTATGGAACATTATGCCAGTCAAGAGGATCTGGTTGTCTTGTTTACTGAATGCTTTGATGTCATATTTGCTGGTGGTCCAGAAGAAGTTCTAAAAAAGTTCCAAAAGTCAAACCATAAAGTGGTCTTTGCAGCTGATGGAATTCTGTGGCCAGATAAAAGACTAGCAGACAAGTATCCCATTGTGCACATTGGGAAACGCTACCTGAATTCGGGAGGATTTATTGGTTATGCTCCATATATCAACCGTATAGTTCAACAGTGGAATCTACAGGATAATGATGACGATCAGCTATTTTATACTAAAATTTACATTGATCCACTGAAAAGGGAAGCTATTAATATCACATTGGATCACAAATGCAAAATTTTCCAGGCCTTAAATGGAGCTGTAGATGAAGTTGTTTTGAAATTTGAAAATGGCAAAGCCAGAGCTAAGAATGTGTTTTATGAAACATTACCAGTGGCAATTAATGGAAATGGACCCACCAAGATTCTTCTGAATTATTTTGGAAACTATGTACCTAATGCATGGACACAGGATAATGGCTGCACTCTTTGTGAATTGGATACAATTGACTTATCTGCAGTAAATGTCTATCCAAATGTAACAATAGGTGTTTTTATTGAACAACCAACCCCTTTCCTATCTCGATTTCTGGATGTATTGTTGACACTGGATTACCCTAAAGAAGCACTTAAAGTCTTTATTCATAACAAAGAAGTTTATCATGAAAAGGACATCAAGGTATTTTTTGATAAAGCTAAACATGAAATCAGTACTATAAAAGTAGTAGGACCAGAAGAAAATCTAAGTCAAGCTGAAGCCAGAAACATGGGAATGGATTTTTGCCGTCAAGATAAGAACTGTGATTACTACTTTAGTGTAGATGCAGATGTGGTTCTGACAAACCCAAGGACTTTAAAAATTTTGATTGAACAAAACAGAAAGATCATTGCCCCTCTTGTAACTCGTCATGGAAAGCTTTGGTCCAACTTCTGGGGAGCATTGAGTCCTGATGGATACTATGCTCGATCAGAAGATTATGTGGATATTGTTCAAGGGAATAGAATAGGGATATGGAATGTCCCGTACATGGCTAATGTCTACTTAATTAAAGGAAAGACGCTCCGATCAGAGATGAATGAAAGGAACTATTTTGTTCGAGATAAACTGGATCCTGATATGGCTCTTTGCCGAAATGCTAGAGAAATGACATTACAAAGGGAAAAAGACTCCCCTACTCCGGAAACATTCCAAATGCTCAGCCCCCCAAAGGGTGTATTTATGTACATTTCTAATAGACATGAATTTGGAAGACTATTATCAACTGCTAATTACAATACTTCCCATTATAACAATGACCTCTGGCAGATTTTTGAAAATCCTGTGGACTGGAAGGAAAAGTATATAAACCGCGATTATTCAAAGATTTTCACTGAAAATATAGTTGAACAGCCTTGTCCAGATGTCTTTTGGTTTCCCATATTTTCTGAAAAAGCCTGTGATGAATTGGTGGAAGAAATGGAGCATTATGGCCAGTGGTCTGGAGGCAAACATCATGATAGCCGTATTTCTGGTGGTTATGAAAATGTCCCAACTGATGATATCCACATGAAACAAATTGATCTGGAGAATGTATGGCTTCATTTTATCCGGGAGTTTATTGCACCTGTTACACTGAAGGTCTTTGCAGGCTATTATACAAAGGGGTTTGCATTACTGAATTTTGTGGTAAAATACTCCCCTGATAGACAGCGTTCTCTTCGCCCTCATCACGATGCTTCTACATTTACCATCAACATTGCACTCAATAGTGTGGGAGAAGATTTTCAGGGAGGTGGATGCAAATTCCTAAGGTACAATTGCTCTATTGAATCACCAAGAAAAGGCTGGAGCTTCATGCATCCAGGGAGACTCACACATTTGCATGAAGGACTTCCTGTTAAAAATGGAACACGATACATTGCAGTGTCATTTATAGATCCCTAAGTTATTTACTTTTCATTGAATTGACATTTCTTTGGAATGGATGACTGGTATGAACATATTTTTGAAGTTGTGCTTGAGAAGATGAGAGGAATATTTAAATATTCCACAGAACAACCTAACTTTGGGCCAAACATTTGAAAAACTTTATAAAAAATTGTTTGATATTTCCTAATGTCTGCTCTGAGCCTTAAAACACAGATTGAAGAAGAAAGGAAAAAAGTAAACACAAATATTTATTTCTGTGCCTTATTGTCTTTGAGAATAATGAGAATTTTCTGAATTTGTGTTTCAGTTGATAAAATATTCAGGTACAAATGTACAAGCAACAAATGAGACTGGTAATATTTTATTTAACAAAAGCCTAAGAAGAATTTTATTTATCAACATATAGATGAAGTGAATATAAATGAAAATTGGCAATTTTTAAAATGTCTAAAAACTGGAATTCTAACTGAATTTGTGTGCAACTTATTGTGTAAGTACTTTTTGACCACCTATGCAAGTATGTTTTAAAGTATAGTTCCTGAAGGAATACCAAGAACAATATTACAGTTTTTTTCCTTGAGAAAATTAGTATAAAATGCAATTAGGTGCATACCCAGTTGAAAACATTTTTGTTTAGATTGTTAGACAGACTTTTTTTTACATTTGTATTAGAAATCAAGCCCTGTGTTCCTTCAGATAAATTTTCCAAGGTAGATTATAGTAAATAGATACTAGATTTAGAAAAGCTTTCAAGCCTTTCCATTTCTTATTGACTTAAGATCACCAAGTGACCTTAAGTCAAAAAGGTTGTCGTTCTTTTAATTCTAGAAAATAATGAGGAAATTTTTTTCTTTGAGATTAGTAGTAGCATTTTGATTTTAAAAAATTAAGTACTTGAATTTTATATCAGGAAAATAAAGTTGGTGAGCCTTTCTTCCTTTTTGCCCTTTGTCTCCCTCTTTATGTTCTTTTTTGTGAAGGTTATCCTCTTTTTTGTCTTCCCAGCGTAGTCTCCATTTTATCCTTCTTACTCTTTTTATTACCTTCTCTTTATCACACTTTAGAATAATTTCCTAGCACAAAAAAATTTGTGACTTGATTTTTCACCATTTCTCTGAGTGAGGTTTAAATATCCTTATTGTAGCTACTGTTTTTAATTTAAAGGTTAAACTTGAAAAAAAAGTTCTAAGTCATGGTGCCAAAATTTATTTTTCTAACACTGTGTGTTAGAAAATTATG