Transcript asmbl_18161

Sequence
Transcript Sequence for observation asmbl_18161 of TGE0003992:
CCTGGAAGCGGAAGAGATTTCGTTTTTCTCTTACGCACTCTCGTGCGTCTCACCTGCGTAGTTTTTGCCCGGCGGGAACGCGCAGCGGGGGAAGTTTGTCTCGGTGAAGGGAAGCTTAACGCTGAGACCCCGGAGCGGCGGCAGCCATGGCGGATGTGACCGCCCGTAGCCTGCAGTACGAGTACAAGGCGAACTCGAATCTTGTCCTCCAAGCTGACCGCTCTCTCATTGACCGTACCCGCCGGGATGAGCCCACGGGAGAGGTGCTGTCCCTGGTTGGGAAGCTGGAGGGCACCCGGATGGGAGATAAGGCTCAACGGACCAAACCGCAGATGCAGGAGGAAAGAAGAGCCAAGCGAAGGAAGCGTGACGAGGACCGGCACGACATCAACAAGATGAAGGGGTACACGCTGCTCTCAGAGGGTATCGACGAGATGGTGGGCATCATTTACAAGCCCAAAACCAAAGAGACCCGGGAGACCTACGAGGTGCTGCTTAGCTTCATCCAGGCTGCCCTTGGGGACCAGCCACGTGATATTCTGTGTGGGGCAGCTGATGAAGTTCTAGCTGTCCTAAAGAATGAAAAGCTTCGTGATAAAGAAAGGAGAAAGGAGATCGACTTGCTGTTGGGTCAGACAGATGATACCAGATACCATGTTCTAGTGAACTTGGGCAAAAAGATCACAGACTACGGTGGAGACAAGGAAATCCAGAACATGGATGACAACATTGATGAAACATATGGCGTGAATGTACAGTTTGAGTCTGATGAGGAGGAAGGTGACGAAGATGTGTATGGGGAGGTTCGAGAAGAGGCCTCCGATGACGACATGGAAGGGGACGAGGCAGTGGTGCGCTGCACCCTTTCGGCTAATCTTGTTGCATCTGGGGAACTGATGAGTTCCAAGAAGAAGGATTTGCACCCTCGGGACATTGATGCCTTCTGGCTGCAGCGGCAGCTCAGTCGCTTCTATGATGATGCCATCGTGTCGCAGAAGAAGGCAGACGAAGTGTTGGAGATCTTGAAGACAGCGAGCGATGATCGGGAGTGTGAGAACCAGTTGGTGCTGCTGCTCGGCTTCAACACTTTCGATTTTATTAAAGTGCTGCGGCAGCACAGGATGATGATTTTGTACTGTACCTTGCTGGCCAGTGCTCAGAGTGAAGCTGAAAAGGAAAGGATCATGGGAAAGATGGAGGCCGACCCAGAGCTCTCGAAGTTCCTCTACCAGCTCCACGAGACGGAGAAGGAGGATCTGATCCGGGAGGAGCGGTCCCGGAGGGAGCGAGTGCGGCAGTCCCGAATGGACACTGACCTGGAAACCATGGACCTGGACCAGGGTGGGGAGGCACTGGCCCCGCGGCAGGTTCTCGACTTGGAAGACTTGGTCTTTACCCAGGGGAGCCACTTCATGGCTAATAAACGCTGTCAGCTTCCAGATGGATCCTTCCGTCGCCAGCGCAAGGGCTACGAAGAGGTGCATGTACCTGCTCTGAAGCCCAAGCCTTTTGGCTCAGAGGAGCAACTGCTTCCAGTGGAGAAGCTGCCCAAGTATGCCCAGGCTGGCTTTGAGGGCTTCAAAACACTGAACCGGATCCAGAGTAAGCTGTACCGGGCCGCCCTGGAGACAGATGAGAACCTGCTGCTGTGTGCCCCCACTGGCGCCGGCAAGACCAACGTGGCTCTGATGTGCATGCTCCGAGAGATAGGGAAGCACATCAACATGGATGGCACCATCAATGTGGATGACTTCAAGATCATCTACATCGCTCCCATGCGGTCTTTGGTGCAGGAGATGGTGGGCAGCTTTGGAAAGCGCCTGGCTACCTACGGCATCACTGTCGCCGAGCTGACGGGTGACCACCAGCTGTGCAAGGAGGAGATCAGTGCCACTCAGATCATTGTCTGCACCCCCGAGAAGTGGGACATCATCACCCGCAAAGGCGGCGAGCGCACATACACCCAGCTTGTGCGGCTCATCATCCTGGATGAGATCCATCTCCTTCATGATGACAGAGGTCCTGTCTTAGAGGCGTTGGTGGCCAGGGCCATCCGAAACATTGAAATGACCCAAGAGGATGTCAGGCTCATCGGGCTTAGCGCCACCCTCCCCAACTATGAGGACGTGGCTACCTTTCTACGCGTTGACCCTGCCAAGGGCCTTTTCTACTTTGACAACAGCTTCCGCCCAGTGCCTCTGGAACAGACCTACGTGGGTATCACAGAGAAAAAAGCCATCAAGCGTTTCCAGATCATGAATGAGATAGTCTATGAGAAGATCATGGAACATGCTGGAAAAAATCAGGTACTGGTGTTTGTCCATTCCCGGAAGGAGACGGGGAAGACGGCCAGGGCTATCCGGGACATGTGCCTTGAGAAGGACACACTGGGCCTATTTCTCCGAGAGGGCTCTGCCTCCACCGAGGTCCTGCGGACGGAAGCCGAGCAGTGCAAGAACCTGGAGCTGAAGGACCTTCTGCCCTATGGCTTTGCCATTCACCATGCGGGCATGACCAGGGTGGACAGGACACTTGTGGAGGATCTCTTTGCTGACAGGCACATTCAGGTTTTAGTCTCCACAGCAACTCTGGCTTGGGGTGTGAACCTCCCTGCACACACAGTTATCATCAAAGGCACCCAGGTGTACAGTCCGGAGAAGGGGCGCTGGACGGAACTGGGGGCTCTGGATATTCTGCAGATGCTGGGACGTGCTGGAAGACCCCAGTACGACACCAAGGGTGAAGGCATACTCATCACGTCTCACGGGGAGCTCCAGTACTACCTGTCCCTCCTCAACCAGCAGCTTCCTATTGAGAGCCAGATGGTGTCAAAGCTGCCCGACATGCTCAACGCGGAGGTGGTACTGGGCAATGTCCAAAACGCGAAGGATGCGGTGAACTGGTTGGGCTATGCCTACTTGTACATACGCATGCTGCGGTCCCCAACCCTCTACGGCATCTCTCACGACGATCTCAAGGGAGACCCCTTGCTGGACCAGCGCCGACTGGACCTGGTTCACACTGCCGCCTTGATGCTAGATAAGAACAACCTGGTCAAGTATGACAAGAAGACGGGAAACTTCCAGGTGACAGAACTGGGTCGTATAGCCAGCCACTACTACATCACCAATGACACGGTGCAGACCTACAATCAGCTGCTGAAGCCCACCCTGAGTGAGATCGAGCTTTTCAGGGTCTTCTCGCTGTCCTCGGAGTTTAAGAACATCACCGTGAGAGAGGAGGAGAAACTGGAGCTGCAGAAGCTGTTGGAGCGGGTGCCCATCCCTGTGAAGGAGAGCATTGAGGAACCCAGTGCGAAGATCAATGTGCTTCTCCAAGCCTTCATCTCACAGCTGAAATTGGAGGGCTTTGCACTGATGGCTGACATGGTATATGTGACACAGTCAGCGGGCCGGTTGATGCGGGCCATCTTTGAAATTGTTCTGAACCGAGGTTGGGCGCAGCTGACAGACAAGACCCTGAACCTCTGCAAGATGATTGACAAACGCATGTGGCAGTCCATGTGTCCTCTGCGTCAGTTCCGGAAACTCCCTGAGGAGGTAGTGAAGAAGATTGAGAAAAAGAACTTCCCTTTTGAGCGTCTGTACGACCTGAACCACAATGAGATAGGGGAGCTCATCCGCATGCCCAAGATGGGCAAGACAATCCACAAGTACGTCCACCTGTTCCCCAAGTTGGAGCTGTCTGTGCATCTGCAGCCCATCACGCGCTCCACCTTAAAGGTGGAGCTGACCATCACGCCGGACTTCCAGTGGGATGAAAAGGTCCATGGTTCATCAGAGGCCTTTTGGATTCTGGTGGAGGATGTGGACAGCGAAGTGATACTGCACCATGAGTACTTTCTGCTCAAGGCCAAGTACGCCCAGGACGAGCACCTTATCACGTTCTTCGTGCCTGTTTTTGAACCGCTGCCCCCTCAATACTTCATCCGTGTGGTGTCTGACCGCTGGCTCTCTTGCGAGACCCAGCTGCCTGTCTCCTTCCGACACCTGATCCTGCCGGAGAAGTACCCGCCTCCCACCGAGCTGCTGGACCTGCAGCCCTTGCCCGTGTCCGCCCTGAGAAACAGTGCCTTCGAGAGCCTTTACCAAGACAAATTCCCCTTTTTCAATCCCATCCAGACACAAGTGTTCAACACCGTGTACAACAGCGACGACAATGTGTTTGTGGGGGCCCCCACCGGCAGTGGGAAGACCATCTGTGCGGAGTTCGCCATCCTGCGGATGTTGCTGCAGAACTCGGAGGGGCGCTGCGTCTATATCACCCCCATGGAGGCACTGGCCGAGCAGGTGTACATGGACTGGCACGAGAAGTTCCAGGACAGGCTCAGCAAGAAGGTGGTGCTCCTGACGGGCGAGACCAGCACGGACCTGAAGCTGCTGGGCAAGGGCAGCATTGTCATCGGTACCCCCGAGAGGTGGGACATCCTCTCTCGGCGCTGGAAGCAGCGCAAGAACGTCCAGAACATCAGCCTGTTCGTGGTGGACGAGGCCCACCTCATCGGGGGCGAGAACGGGCCTGTCTTGGAAGTGATCTGCTCCCGGATGCGCTACATCTCCTCCCAGATTGAGCGGCCCATTCGTGTTGTGGCGCTTAGCTCCTCGCTCTCAAATGCTAAGGACGTGGCCCACTGGCTAGGCTGCAGTGCCACCTCCACGTTCAACTTCCACCCGAACGTGCGCCCCGTGCCTTTGGAGCTGCACATCCAGGGCTTCAACATCAGTCACACGCAGACTCGCCTATTGTCCATGGCCAAGCCAGTGTACCATGCCATCACCAAGCACTCTCCCAAGAAGCCTGTCATCGTTTTTGTGCCTTCTCGTAAGCAGACCCGCCTTACGGCAATTGACATCCTCACCACGTGTGCGGCGGACATCCAACGACAGAGGTTCTTACACTGCACCGAGAAGGATCTGATCCCGTACCTGGAAAAGCTGAGTGACAGCACGCTCAAGGAGACGCTGTTAAACGGCGTGGGCTACTTGCATGAGGGTCTCAGCCCCCTGGAGCGGCGTCTGGTGGGACAGCTCTTCAGCTCAGGGGCCATCCAGGTAGTTGTTGCTTCTCGGAGTCTCTGCTGGGGCCTGAGTGTGACCGCCCACCTGGTGATCATCATGGACACCCAGTACTACAATGGCAAGATCCACGCGTATGTGGACTACCCCATCTATGATGTGCTTCAGATGGTGGGGCACGCCAACCGCCCTCTGCAGGATGACGAGGGGCGTTGTGTCATCATGTGCCAGGGCTCCAAAAAGGATTTCTTTAAGAAGTTCTTATATGAGCCATTGCCAGTGGAGTCTCACCTGGACCACTGTATGCATGACCACTTCAATGCCGAGATTGTCACCAAGACCATTGAGAACAAGCAGGACGCTGTAGACTACCTTACCTGGACCTTTCTGTACCGCCGCATGACGCAGAACCCCAACTACTACAACTTGCAGGGCATCTCCCATCGTCACCTGTCTGACCACTTGTCAGAGCTGGTGGAGCAGACGCTGAGTGACCTGGAGCAGTCCAAGTGCATCAGCATAGAGGACGAGATGGACGTGGCTCCTCTAAACCTGGGCATGATCGCCGCCTACTACTACATCAACTACACCACTATCGGTGAGGCCGGCTGGGGCAGCTTTTGGCTGTGGGTGCAG