Transcript asmbl_49697

Sequence
Transcript Sequence for observation asmbl_49697 of TGE0001625:
CTTTGCTACTTTCCGGTCGAAGAGAGTGTTCCTGCTCTGACGTCGGCGGCCCTCCGTGAGGGAGGCAAGACGGCGGAACCGCAGCCATGACTGAGGCTGATGTAAATCCGAAGGCCTACCCTCTCGCAGATGCCCACCTCACCAAGAAACTATTGGACCTCGTTCAGCAGTCATGTAACTATAAGCAGCTTCGGAAAGGAGCCAATGAAGCCACCAAAACCCTCAACAGAGGCATCTCTGAGTTCATTGTGATGGCTGCAGACGCCGAGCCCCTGGAGATCATTCTGCATCTCCCACTGCTGTGTGAAGACAAGAATGTGCCCTACGTGTTCGTGCGCTCCAAGCAGGCCCTGGGGCGGGCTTGTGGGGTCTCCAGGCCTGTCATCGCCTGTTCTGTCACCATCAAAGAAGGCTCACAGCTGAAGCAGCAGATCCAGTCCATTCAGCAGTCCATCGAAAGGCTCTTAGTCTAAACCGGTGGCCTCTGCCACACTCTCCTACTGACTCCTCCCTCCGGGTTGTGTATCATATTTTCTGTTAGCATGTAGTATTTCCAGCTACTTTCTATTGTTATAAAATATTGTAATACTAAGTCTGGTTTTTACACTTTTGTATTATTTTTGTTTTGTCTTACAGGTCGTCATCTGCCCCCTACCCCTACCCTAATCTTTCTTTCCATTTTCTGCTGTCTTTCCTCCCTTTCAAAAAATGAACTAATGCCCAGAACAGGCAGAAACAGAGTGGTGACACCATTCAAAGGCAGAGAAGAGCCAGGATTGAGATCCACTTCCAGCTTTCAGGCACTAACTCCCTACTGTGTGCAGGACATGATAAAGTAACCACCACCCACTTGGTATCCCTTGTGGCTGGCATACATAATTATTCCATACTTGTTTAAATGATCTGGGGGTTTCCTTTGCTTTCCAGGGGATTATATATCATTTGGGGAGGAAGCATGTATTCTGCGAGGTGGTTCGTTGTGTCATTTGCTAACATGCCACTGCTGTTTCCTTTTGGGAATATGTTATGTTCCCCCCTAACTCCCAGCTGTGCCCCTGAGGGTGACAGGACAGCACCGTACCAGAGAGATATGTGCGCAGAATTCCAGAGGTGGCCTAGGCGAGTGAGTTATGGGGCTTCAAGGAGTCTGGAGGGGCAAGAGAAGAGGCTCAGCTGGTTCTGGAATGCAGGATTCGGGGCAAGTCATGGAGACCTAGAAGCTACAGCAGAGATGATGGGTCCAAGGAGACAGCCTCTGGTGACTGCAGATTTCTTCAGTGGACACTTGGTACCAGCTCTGAGAGCCCTTAACCCTATTTCCTGGGTCAGGTGTATGTTCTTTATCACATCAGAAGGACAGTGCTAATGTGTCATTCTTGTGAGCATCCTAGTAAAGAAATATATTCATAGTCCAATTTAAAGAAAGTGTCATTCTTGGTAGGTATCCAGCTAATACCTGTTTGAAGAACTACTTAGCATTATTAGAGTGGTTTTAGCTTCTCAAACTTTCCACCAAGAAGCTGTGGAAAGCCATTTCCTACCAGATGATTTCCGGTAGTTCAAAATGATGGTTTTAGCTTCTCAAACTTTCCACCGAGAAGCTGTGGAAAGCCATCATTTCCTACCAGATGATTTCCGGTAGTTCAAAATATCTAATAAA