Transcript asmbl_18146

Sequence
Transcript Sequence for observation asmbl_18146 of TGE0003991:
CCATGCCTTACTGGCTGAGGTGAAGGGATGCTGACCTGCTGACAGGTACGCAACAGGACGCACAACAGGAGTGGTCTTAGATTCAGGGGACGGGGTCACCCATGCTGTTCCCATCTACGAGGGCTTTGCCATGCCGCATTCCATCATGCGGGTGGACATTGCCGGCCGCGACGTCTCCCGCTATCTCCGGCTGCTGCTGCGCAAGGAAGGCGTTGACTTTCACACCTCAGCTGAGTTTGAGGTTGTCCGAACCATCAAAGAGCGGGCCTGCTACCTGTCCATCAACCCACAGAAGGATGAGGCTCTGGAGACAGAGAAGGTGCAGTATACTTTGCCGGATGGCAGCATACTCGACGTGGGGCCAGCACGATTCCGGGCCCCTGAGCTGCTGTTCCAGCCGGACCTGGTGGGGGACGAGAGTGAGGGGCTCCATGAGGTGCTGGCTTTTGCCATCCACAAGTCCGACCTGGACCTCCGCCGGACACTGTTCGCCAACATTGTGCTTTCAGGCGGCTCCACGCTGTTCAAAGGCTTTGGGGACCGATTACTAAGTGAAGTGAAGAAGCTTGCACCAAAGGATGTCAAAATCAAGATCTCGGCCCCCCAGGAACGGCTGTACTCCACATGGATCGGTGGCTCCATCCTGGCCTCACTGGACACTTTCAAGAAGATGTGGGTCTCCAAGAAGGAGTACGAGGAGGATGGCGCCCGTGCTATTCATCGTAAAACCTTCTAGCGCCCAAGGAGAAAGGCAGTGTGCTGGGCGAGTGGGAAGAAAGGGGCCAGAGCCCCAACCCTGTCTGGTCTGGGCCCACATACACCAGGCCCAGGGTTCCCTGTGTGCCCTGAACCCCGGGAAGGCGGTACAGCATCTTCCCTGCAGCCCTCCCCTTTGCACACACACGCACACACAGTAACGTTTAGCTGCATGGGTGGGGGTCTTGAGCTGGAACATAGAAATTGATGTGCCCAGCCATAGGTGGTTCTGGGTGTCCCTTTGGCAGGGCCAGTTAGGGCTACGGTTCCTGGCTCTGATCCTTGGGGCTGCTTCTTCCCCAGGCTCCAAGGCTTGACCCCCGAATGCCCCCGTTTCCTCTGACAGGGTCCCTCCCAGGACGAGGGCACCCGGGTGCCTGTGTAATTAGCCTTGGGGAGTGGGATAGAGGAGAAGGTGTCCAGCAGCTCCCCACTGGTGCATCCTTGCTTCTCGTGCCATCTCATCTTCCTGACCCGACAGAGTAGCACAGAGGGCCAGCCACTCCTGGCATAACTGGCCTCCCACACTGTCCCCCTCATCTTCCTGAGTGGATGTCTTTGTGTAGGCTGAGTACTGAGCAGTCTGCTGTCCCCAGTGAGGGGGTCTGACATAGGGTTGCACCCCCTGGAGCCAGGGCAGCAGATGCTTGGGGTTTGGACAGCCAGTCTGTTGCGCTGTCCCTTTCACAGTGCTTCACTGCCTTGCTTCTCCCCTGTCCTTTACCCTGGGCAAGCGTTAGTGGTCTTCCCTTGTTGAGAGTCAGACCCAGAGGGGTGAGGGGAAAGATCTCCTGTCCCACCTCACCCACTGGGAGGGTCATTACCCTGGGCCAGGGCCCCTCCCCGTCCCAGGTATGTACAATAATTTAACACAGTTGCCTGAAGAAAACTTTTTTGTAAATCATTATAGTAATAATTATCAACAA