Transcript asmbl_17930

Sequence
Transcript Sequence for observation asmbl_17930 of TGE0003988:
CCACCCTGCACCTTGGGCTGGAAGCTGAGACGGATTCCCCAAAGATGCTCCAGTTGCAGGAGCGAAGCAAATTTATCATTGTCCCGAGGAAAGGGAGCAGCGTGATTCTTACCCGTTTCAGTAGAACGACTGGCATCCTTCAGCTGCACAAGCCAGTGCTCGGGTTGTGATTTTCCTGGGGAAAGTGGAGACCAGCACGCCTGCTTGCGCTCCTTCCCTCCTCCTGGAGCCAGCCGTGTTTGCTGCTGCGATTCGCCAACGTGCCCCTCCTCTAACTGCGGCTGGTTCCGTCTACCTCTTACACTTCATTTATCTGTAGATCATTTGGATAGCCCGTCTTGTAAATGTTTAGCATTTTGGTGTTTTACTGCTTCTTTCTGGGGGCATTTCCAGCACTTGCCGAGACCGGCGAAGGGAGGCGACTGTGCCCGGAGAAGAGCGAAATATGGGGACCTGGTCTAAAAGCAGCTGTTGTCCTTCCCGCACGCTATTTCTATATTCAGGCGGTGGATACATCAGGAGATAAGTTCAGATCTTCTCCAGGTGAAAAAGTGTTCCAGATTAAAATCACAGCACCAGATGAGCAATTCACTAGAGTTGGAGTCCAAGTTTTAGACCGAAAGGATGGGTCCTTCATAGTAAGATATAGAATGTATGCAAGCTACAAAAATCTGAAGGTAGAAGTTAAATTCCAAGGTCAACATGTGGCCAAATCTCCATATATTTTAAAAGGGCCCGTTTACCATGAGAATTGTGACTGTCCTTTGGAAGATAGTGCAGCCTGGCTACAGGAGATGAAGTGCCCAGAAACCATTGCTCAAATTCAGAGAGATCTGGCACATTTTCCTACTGTTGATCCAGAAAAGATTGCAGCAGAAATTCCAAAGAGATTTGGACAAAGGCAGAGCTTGTGTCACTATACCTTGAAGGATAACAAGGTGAAGATGCCAGATATGGAGTTTTTTGTTAATTTGGGAGACTGGCCTTTGGAAAAAAAGAAATCCAATTTACACATCCATCCAATCTTTTCCTGGTGTGGCTCCACAGATTCCAAGGATATCGTGATGCCTACCTATGACCTGACCGACTCTGTTCTAGAAACCATGGGCCGAGTAAGTCTGGATATGATGTCTGTGCAAGCTAACACGGGTCCTCCCTGGGAAAGCAAAAACTCCACAGCTGTCTGGAGAGGGCGAGACAGCCGCAAAGAGAGACTCGAGCTGGTTAAACTCAGCAGAAAACACCCAGAACTCATAGATGCTGCCTTCACCAACTTTTTCTTCTTTAAACACGATGAAAGCCTGTATGGTCCCATTGTGAAACACATTTCATTTTTTGATTTCTTCAAGCATAAGTATCAAATAAACATTGACGGCACTGTCGCAGCATATCGCCTGCCATATCTTCTAGTCGGTGACAGTGTTGTGCTGAAGCAGGACTCCATCTACTATGAACATTTTTATAATGAGCTACAGCCCTGGAAACACTACATTCCAGTTAAAAGCAACCTGAGCGATCTCCTAGAAAAACTTAAATGGGCAAAAGATCACGATGAAGAGGCAAAGAAGATTGCAAAAACAGGACAGGAATTTGCAAGAAATAATCTCATGGGTGATGACATATTCTGTTATTATTTTAAACTTTTTCAGGAATATGCTAGTTTACAAGTGAGTGAACCCCAAATCCGAGAGGGCATGAAGAGGGTAGAGCCACAGTCTGAGGATGACCTCTTTCCTTGCACGTGCCTTAGGAAAAAGACCAAAGATGAACTCTGATTTGCAAAATACCTTCCCTTCAAATAATGGTGCTCTGAAGACTCTTCTTAACTGAAAAGAAGAATTTTTTTAGAATATTAATTCTGTGGACAGTATAAAATCTATGTGATTGTCTGGGTTAAGAAGATATGTTTCTTATTATGCAGTATTCTCATGACTGTCCTTTAAAG