Transcript asmbl_49102

Sequence
Transcript Sequence for observation asmbl_49102 of TGE0027813:
AGTGGAGAAGAGTTCGATTGTGCTTTCCGGCTGGCACAGGAGGGAATATATACACTGTATCCATTTATTAACTCAAGAATCATTACTGTGTCGTTGGAAGACGTTAAAATCCTATTAACCCAGGAAAATCCATTTTTTAGAAAACTTAGCAGTGAGACGTACAGCCAAGCCAAGGACCTGGCCAAGGGGAGTGTCGTCCTGAAGTACGAGCCAGACCCCACGAAACCAGACACCCTGCAGTGTCCCATCGTGTTGTGTGGATGGCGGGGAAAGGCCTCAATTCGAACTTTCGTGCCCAAGAATGAGCGGCTGCATTACCTCAGGATGATGGGGCTGGAGGTGCTGGCAGAGAAGAAGAAGGAAGGGCCTGTCCTGACAGGCGACAGTGCCTCTGGCTCCGGGCCACCGGAGGACGAGGCGAGTGCCGACCGGGACGAAGAGCAGGCTGCCAGTGTGGACGGCGCAGGCGGTGACCCGGCCGGGGGTCCTGGGGCGTCTGCACCCCAGTCCAGAACTGCTGACCTGTAAAGCACGATTTTAACGGCTGGAAACAGACGGGATGGTAGAAGCTTCTGCGAGTGACCGCCGTCCTGCTGTCGCACGGCGTGTGAGGAAAGTATGTTTTCAGCTTGTTCGTTGCTCCTTTTACTTTGTTCTCTGGCGAAGCTGGGCCCAGCGCCTGCTGCCGGTGGGAGGCTTCGTGGTCGAGGTCTCGCTTCCATCAAGAAATGTCACTGCCCACGCAGAAACGTTCAGGTCCCTTCATTACACCTGCATTGGTCTTAAAGTCCAGTATTTCTTTTAATTATTATTTATAGGGAGGATCTGTATGTCCTTACGAGTCGTTGGAAACCATGCTGTAAGCTTTAATAATTGTATTAAGTTGCGTATCAGTGCGACATCGGTGCACAGTGGGTTAATATCCGGGCTGTCAGACGGCTTCTGTGCCTTTATAACAAAGAGTGAAATGTATCCTGTCATGTCAGAGAGACCTGCGTCATGAACTGTGAGGCTCATGAGGGTTTTATGTGCTTTTAGGAAACGAAGCACTTTGCAGTTTTAATTTTTTAATGGGGTTTGGGATGCCTGGAACGTTTAATTAAAGAGACTAATGAAATGTGTA