Transcript asmbl_49099

Sequence
Transcript Sequence for observation asmbl_49099 of TGE0027812:
GGGCTGGGAAGGCGGGTACCCCGAAATCGTCAAAGAGAACAAGCTCTTCGAGCACTACTACCAGGAGCTGAAGATCGTGCCGGAGGGCGAGTGGGACCAGTTCATGGAAGCGCTCAGGGAGCCCCTCCCGGCCACCTTAAGAATTACTGGTTACAAAAGCCACGCGAAAGAGATTCTCCATTGCTTAAAGAACAAGTATTTCAAGGAATTGGAAGACCTGGAGGTGGACGGTCAGAAAGTTGAAGTTCCACAACCCCTGAGTTGGTATCCTGAAGAACTTGCCTGGCACACAAATTTAAGTCGAAAAATCTTGCGAAAGTCTCCACAATTGGAAAAGTTTCACCAGTTTCTGGTTAGCGAAACCGAATCTGGAAACATCAGTCGTCAAGAAGCCGTTAGCATGATTCCACCGCTGTTGCTTAATGCTCATCCTCACCACAAGATCTTAGATATGTGTGCAGCGCCTGGATCGAAGACCACGCAGTTAATCGAAATGCTGCATGCCGACATGAGCGTCCCTTTCCCAGAGGGATTTGTCATCGCGAATGACGTGGACAACAAACGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGCTGAGCAGCCCGTGCATCATGGTGGTCAACCACGACGCGGCCAGCATCCCGAGACTCAGCGTGGACGTGGGCGGGAGGAAGGAGATTCTCTTCTACGATCGCATCTTATGCGACGTCCCCTGCAGTGGAGATGGCACTATGAGAAAAAACATCGATGTTTGGAAAAAGTGGACCACGTTAAACAGCTTGCAGCTGCACGGCTTACAGCTACGCATCGCCACGCGGGGGGCTGAGCAGCTGGTAGAAGGCGGTCGGATGGTTTACTCCACGTGTTCCCTGAACCCTATCGAAGATGAAGCAGTCATAGCATCTTTACTGGAAAAAAGCGAAGGTGCCTTGGAGCTTGCTGACGTGTCTTCTGAGTTGCCGGGACTAAAGTGGATGCCTGGACTCACCCAGTGGAAGGTCATGACAAAAGATGGACAGTGGTTCGCATCGTGGGACGAGGTTCCTCACAGCAGACACACCCAGATCCGTCCCACCATGTTCCCACCGAAGGACGCGAACACGCTGCAGGCCATGCACCTAGAGCGGTGTCTTAGAATATTACCACATCATCAAAATACTGGCGGGTTCTTCGTGGCAGTATTAGTGAAAAAGTCTTCGATGCCATGGAATAAGCGTGCACCAAAGCTGCAGGGAGACTCTGCGGAGCTGAGGGCGCCTGCGCAGTCCAGCCCTGCAGGTCCCACGGGAGGGACAGCTGCGGGTCCCTCCGAGCTGGAAAGGACACCAGTCACTGGAATGGGTGACGCGGAAGTAATTGAAAGAACTGAGAACTTAGACGATAACGGAAACAAGAAAGACGGCGTGTGTGGTCCTCCTCCATCGAAGAAAATGAAGCTGTTTGGATTTAAAGAGGATCCGTTCGTGTTTATTCCTGAAGATGACCCATTATTTCCACCTATCCAGAAATTTTACGCTCTGGACCCTTCGTTCCCGAGGATGAATTTGTTGACGCGAACGACGGAAGGGAAGAAAAGGCAGCTCTACATGGTCTCCAAGGAGCTGCGGAACGTGCTGCTGAACAACAGCGAGCGGGTGAAGGTTATCAACACCGGGATAAAAGTCTGGTG