Transcript asmbl_49093

Sequence
Transcript Sequence for observation asmbl_49093 of TGE0005670:
GTTGACTGAGAATCTTTTCCTGTTTGTGAACAAGAGAGAAACTGGTGCGGGTGGATTTACACAGGCCAAGGCAGAATCAGAGAGAAAGTCCTGAGAAGGGGAATGAGTGTGGAAATGACTTGGCCTCTTTGGGGAGAAGCATCTTGGCCTTGGGCAGATGGCATGCTGAGGATGGGTTCAGGGGCTCCAGCAGAGCAAAGCGAAGGGTCCATGGGAAGGAATATGCCAGAACCTGCGTGGGGTGGTGGTCAGAGGGGTTAAATGTTTGTGCTTTCTGTGCACTTTTAATCGCCAGCTGAACTGCTCTTGATTTTGTAGGGTCGATAAAGATCGGAGCGGTGTGATATCCGACAGTGAGCTCCAGCAAGCGCTCTCCAATGGCACCTGGACTCCATTCAACCCCGTGACGGTCAGGTCGATCATATCTATGTTCGACCGCGAGAACAAGGCTGGCGTGAACTTCAGCGAGTTCACCGGCGTCTGGAAGTACATCACGGACTGGCAGAACGTCTTCCGCACCTACGACAGAGACAACTCTGGGATGATCGACAAGAACGAGCTCAAGCAAGCACTCTCAGGTTTCGGCTACCGGCTCTCCGACCAGTTCCACGACATCCTCATTCGGAAGTTTGACCGGCAAGGACGGGGGCAGATCGCTTTTGATGACTTCATCCAAGGCTGCATCGTTTTGCAGAGGTTGACAGATATATTCAGACGCTATGATACGGACCAGGATGGCTGGATTCAGGTGTCCTACGAGCAGTACCTTTCCATGGTCTTCAGCATCGTATAACCCAGGACTTCTGCAAACAGCGACGTGATTACGGAAGAGAGACTGAAAATGCCAAACCTCTTACTTTAACAAAATGGAGCACGGACGCATAGACGCTGTTCTTCCTTCAGGGTTCATGTGATTGGTGTTTGGGGACCCAGCTGTACATATGTAGATAATAAGCTGATCGGCGTTTGCACAGTCGTAACGGTGGTCGTGTCGTTACTCAGATGCAAGCATTTGATTTGGGGCTGTTTAATTGTGCCATAAGGTGAGGCCTGAGAATGCTTCAGGTGTTCTGCATGTATAAAATTTATCATGTGCTTTCCTAGATGGTTCTAATTCTGTAGTAGAAATACCTGTATTAACCAATAAGAGTTTTGAATTAATATGTAACTTGCACAGAAGACTTTTCATGTGCCTTACTTTTTAAAAAAAGGGTTTATTGTATTCATTTGAATATGCAGCGTAAGCAATAAAGCAATGTGCCCCTGTCCCATCCGCCTCAGAAGCGCGTGCGGGGTCCGGGGCATGGCTCTGCC