Transcript asmbl_49092

Sequence
Transcript Sequence for observation asmbl_49092 of TGE0005670:
AGGGTCGATAAAGATCGGAGCGGTGTGATATCCGACAGTGAGCTCCAGCAAGCGCTCTCCAATGGCACCTGGACTCCATTCAACCCCGTGACGGTCAGGTCGATCATATGTCCCAGTCCCGGAGACCGCAAGTGCCCACGGGAGGGGGCTCCGGCCCTTGGCTGCTCACCCGCATCATCGCCCGGTGAAAGTCAGTGAATCGTAGAGCGCTTCTTGCCAAACCAGGAGCTGGAATCACGGTCTCAGTTGACCTCGCTCCCAGAGAAGACACCAAATGACTTATTGTTGTTGTCCTTAGAGCAGTAGTGCAGGCTGAGTGTGTACACGTGTATGTTAGCCGTCTTGCAATTGTATGTAAATGGGGCTTTCGGTTCTTTTGTATTTGGACCTGGAATTGGGCTGGTATCTTAAAATGCAAGGCAGGTCTTGCCGAGAAAGCAAAGCCAGTAGAGTCTTTGTCCTCGGAGGGGGCTCTCCCGGCCACGGGCTCCTCCGAGCCTCCTGGAGGGCAGAGGGGCGCTCCAGGCCCAGAGCTAGGGGCTGGGCGCTTCACTGCCCCTCGGCATCTGCCTGGCAGAGCAGGCGCTCCCTCCCCCCCGTGGTCGTGCTGCCAAGTGAGGCCTTCTCGTTACTGTGGCTCTGATGGTGGGTTTTGCTTGCACGTTCCTTTTCACGGGGGCTGTGGATGGGTGCCAGTCCCCACGCCCCTCACTCTGCCCGTGAGCATTGATCAGCAGCACTTGGGGATTCGCTCGCCAAGCACCGTGCTGGTCCTGTGCTGGTCCCATAGGAAACTAGGGCTCTGGGGACACGGGGACATGGCGGCGTGGGTGCGGGCCCTGCCGATCGACCCCAGGGTTGCGTTTGCCACGCACCACTGACGCCCCTTTCCGTCTCAGCTATGTTCGACCGCGAGAACAAGGCTGGCGTGAACTTCAGCGAGTTCACCGGCGTCTGGAAGTACATCACGGACTGGCAGAACGTCTTCCGCACCTACGACAGAGACAACTCTGGGATGATCGACAAGAACGAGCTCAAGCAAGCACTCTCAGGTTTCGGCTACCGGCTCTCCGACCAGTTCCACGACATCCTCATTCGGAAGTTTGACCGGCAAGGACGGGGGCAGATCGCTTTTGATGACTTCATCCAAGGCTGCATCGTTTTGCAGAGGTTGACAGATATATTCAGACGCTATGATACGGACCAGGATGGCTGGATTCAGGTGTCCTACGAGCAGTACCTTTCCATGGTCTTCAGCATCGTATAACCCAGGACTTCTGCAAACAGCGACGTGATTACGGAAGAGAGACTGAAAATGCCAAACCTCTTACTTTAACAAAATGGAGCACGGACGCATAGACGCTGTTCTTCCTTCAGGGTTCATGTGATTGGTGTTTGGGGACCCAGCTGTACATATGTAGATAATAAGCTGATCGGCGTTTGCACAGTCGTAACGGTGGTCGTGTCGTTACTCAGATGCAAGCATTTGATTTGGGGCTGTTTAATTGTGCCATAAGGTGAGGCCTGAGAATGCTTCAGGTGTTCTGCATGTATAAAATTTATCATGTGCTTTCCTAGATGGTTCTAATTCTGTAGTAGAAATACCTGTATTAACCAATAAGAGTTTTGAATTAATATGTAACTTGCACAGAAGACTTTTCATGTGCCTTACTTTTTAAAAAAAGGGTTTATTGTATTCATTTGAATATGCAGCGTAAGCAATAAAGCAATGTGCCCCTGTCCCATCCGCCTCAGAAGCGCGTGCGGGGTCCGGGGCATGGCTCTGCC