Transcript asmbl_49091

Sequence
Transcript Sequence for observation asmbl_49091 of TGE0005670:
AGGGTCGATAAAGATCGGAGCGGTGTGATATCCGACAGTGAGCTCCAGCAAGCGCTCTCCAATGGCACCTGGACTCCATTCAACCCCGTGACGGTCAGGTCGATCATATGTAAGTAACGGCGCGGCGTCTCGCCCACGTGGGCGAACGGCTGTGAGCCGCTTGTCCAGCTGGTGCATCCCTCCCTGTCCCCGCAACCACACCCCGAGCCCCGGGCAGGCGCGAGGCCCGCTCCGCCTGCCGTGTCCCACACCGACACTTTACTGTTGGTTTCCGCACCTTCGAGGTCCCAGTCCCGGAGACCGCAAGTGCCCACGGGAGGGGGCTCCGGCCCTTGGCTGCTCACCCGCATCATCGCCCGGTGAAAGTCAGTGAATCGTAGAGCGCTTCTTGCCAAACCAGGAGCTGGAATCACGGTCTCAGTTGACCTCGCTCCCAGAGAAGACACCAAATGACTTATTGTTGTTGTCCTTAGAGCAGTAGTGCAGGCTGAGTGTGTACACGTGTATGTTAGCCGTCTTGCAATTGTATGTAAATGGGGCTTTCGGTTCTTTTGTATTTGGACCTGGAATTGGGCTGGTATCTTAAAATGCAAGGCAGGTCTTGCCGAGAAAGCAAAGCCAGTAGAGTCTTTGTCCTCGGAGGGGGCTCTCCCGGCCACGGGCTCCTCCGAGCCTCCTGGAGGGCAGAGGGGCGCTCCAGGCCCAGAGCTAGGGGCTGGGCGCTTCACTGCCCCTCGGCATCTGCCTGGCAGAGCAGGCGCTCCCTCCCCCCCGTGGTCGTGCTGCCAAGTGAGGCCTTCTCGTTACTGTGGCTCTGATGGTGGGTTTTGCTTGCACGTTCCTTTTCACGGGGGCTGTGGATGGGTGCCAGTCCCCACGCCCCTCACTCTGCCCGTGAGCATTGATCAGCAGCACTTGGGGATTCGCTCGCCAAGCACCGTGCTGGTCCTGTGCTGGTCCCATAGGAAACTAGGGCTCTGGGGACACGGGGACATGGCGGCGTGGGTGCGGGCCCTGCCGATCGACCCCAGGGTTGCGTTTGCCACGCACCACTGACGCCCCTTTCCGTCTCAGCTATGTTCGACCGCGAGAACAAGGCTGGCGTGAACTTCAGCGAGTTCACCGGCGTCTGGAAGTACATCACGGACTGGCAGAACGTCTTCCGCACCTACGACAGAGACAACTCTGGGATGATCGACAAGAACGAGCTCAAGCAAGCACTCTCAGGTTTCGGCTACCGGCTCTCCGACCAGTTCCACGACATCCTCATTCGGAAGTTTGACCGGCAAGGACGGGGGCAGATCGCTTTTGATGACTTCATCCAAGGCTGCATCGTTTTGCAGAGGTTGACAGATATATTCAGACGCTATGATACGGACCAGGATGGCTGGATTCAGGTGTCCTACGAGCAGTACCTTTCCATGGTCTTCAGCATCGTATAACCCAGGACTTCTGCAAACAGCGACGTGATTACGGAAGAGAGACTGAAAATGCCAAACCTCTTACTTTAACAAAATGGAGCACGGACGCATAGACGCTGTTCTTCCTTCAGGGTTCATGTGATTGGTGTTTGGGGACCCAGCTGTACATATGTAGATAATAAGCTGATCGGCGTTTGCACAGTCGTAACGGTGGTCGTGTCGTTACTCAGATGCAAGCATTTGATTTGGGGCTGTTTAATTGTGCCATAAGGTGAGGCCTGAGAATGCTTCAGGTGTTCTGCATGTATAAAATTTATCATGTGCTTTCCTAGATGGTTCTAATTCTGTAGTAGAAATACCTGTATTAACCAATAAGAGTTTTGAATTAATATGTAACTTGCACAGAAGACTTTTCATGTGCCTTACTTTTTAAAAAAAGGGTTTATTGTATTCATTTGAATATGCAGCGTAAGCAATAAAGCAATGTGCCCCTGTCCCATCCGCCTCAGAAGCGCGTGCGGGGTCCGGGGCATGGCTCTGCC