Transcript asmbl_49088

Sequence
Transcript Sequence for observation asmbl_49088 of TGE0027811:
ATGAACACTAACCGCGGGTTTTATACCGGACACTTCCATCTTCCGAACCTGTCTCCCATCCTGTCTTTTCCCCCCGCATGCACACAGGGCACCTCTGGTATGACAGGCCCGGAGACCCCGCCCACTTTCTAGCCATGGAGGAGACCGGCCGGGAGGCTGTGGCGACCGCGGTGCAGAGGGTGGCCGGGATGCTCCAGCGGCCGGACCAGCTGGACAAAGTGGAGCAGTATCGCAGGCGAGAGGCCCGGAAGAAGGCCTCCGTGGAGGCCAGACTGAAGGCCGCGATCCAGTCGCAGTTGGATGGGGTGCGCGCGGGCCTGAGCCAGCTGCACAGCGCGCTGAACGACGTGAAAGATGTCCAGCAGTCCCTGGCCGACGTCAGCCAGGACTGGCGGCGGAGCATCAATACCATCGAGAGCCTCCGGGACGTGAAGGACGCCGTGGTGCGGCACAGCCAGCTGGCCGCTGCCGTGGAGAACCTCAAGAACATCTTCTCAGTGCCTGAGATTGTGAGGGACACGCAGGACCTCATAGAGCAGGGAGCGCTCCTGCAGGCCCACCGGAAGCTGATGGACCTGGAGTGCTCCCGGGACGGGCTGATGTGTGAGCAGTACCGCATGGACAGCAGGAACACCCGCGACATGACCCTCATCCACAGCTACTTCGGGAGCACGCAGGCTCTCTCTGACGAGCTGGCCAAGCAGCTATGGATGGTCCTGCAGAGGTCGCTGGTCACCGTCCGCCGTGACCCCACCTTGCTGGTGTCCGTTGTCAGGATCATCGAAAGGGAAGAAAAGATTGACAGGCGCATACTCGACCGAAAAAAGCAGACTGGCTTCGTTCCTCCCGGGAGGCCCAAGAGTTGGAAGGAGAAGATGTTTGCCGTCTTGGACAGAACCGTGACCACCAGAATCGAGGGCACACAGGCAGACACCAGGGAGTCCGACAAGATGTGGCTCGTCCGCCACCTGGAGATCATAAGGAAGTATGTCCTGGATGACCTCGTCGTTGCCAAGACCCTGATGGCACAGTGTTTTCCTCCGCATTATGAGATTTTCAGGAACCTCCTGAGCATGTACCACCAGGCGCTGAGCACGCGGATGCAGGAGCTTGCCTCGGAAGACCTGGAAGCGAATGAGATTGTGAGCCTGCTGACGTGGGTCCTGAACACCTACACGAGTCGAACATCATTGCCTGGCTGCGGAAAGCTCTAGAAACAGACAAGAAAGACTGGGTAAAAGAGACGGAGCCAGAAGCCGACCAAGACGGGTACTACCAGACGACGCTCCCGGCCATCGTCTTCCAGATGTTCGAACAGAATCTTCAAGTTGCTGCTCAGATAAGTGAAGATTTGAAAACAAAGGTGCTCGTTTTGTGTCTTCAGCAAATGAATTCCTTCTTAAGTAGGTACAGAGACGAAGCCCAGCTGTACAAGGAGGAGCACCTGAGGGACCGGCAGCGCCCACACTGCTACGTGCAGTACATGGTCGCCATCATCAACAACTGCCAGACCTTCAAAGAATCCATCGTCAGTTTAAAGCGGAAGTATTTAAGAAGCGCAGGCGAAGACGGCGTGTCCGTGAGCCAGCCGAGCATGGACGGCGTCCTGGATGCCATCGCCGACGAGGGCTGCCGCAGCCTGCTGGAGGAGGTCTTCCTGGACCTGG