Transcript asmbl_48364

Sequence
Transcript Sequence for observation asmbl_48364 of TGE0005638:
CGGAAAAGGTGGGTTTCCGGACGCTGCACCTGCCTGGGTGTAGGTGTAGGTGAGCCGCAGTCTCCGCGAGACCTTCCAGAATTATAAAGCTGTCCTCAGAGATCCGAAAAATGGCAACAAATGAAAATGTCAGCATCTTTAGTTCAGCGTCCTTGGCTGTGGAGTATGTAGATTCACTGTTACCTGAGAATCCTCTGCAAGAGCCATTTAAAAATGCTTGGAACTATATGTTAGATAATTATACAAAGTTCCAGATTGCAACATGGGGATCCCTGATAATTCACGAGGTCATTTATTTCTTGTTCAGTTTACCTGGATTTTTGTTTCAATTTATACCTTACATGAAAAAGTACAAAATTCAGAAGGATAAACCAGAAACATGGGAAGGCCAATGGAAATGCTTTAAAGTACTTCTCTTTAATCACTTTTGTATCCAGTTTCCTTTGATTTGTGGAACTTATTATTTTACAGAGTATTTCAATATTCCTTATGATTGGGAAACAATGCCAAGATGGTATTTGCTTCTGGCAAGATGCTTTGGTTGTGCAGTGATTGAAGATACCTGGCACTATTTCTTACATAGGCTCTTGCACCACAAAAGAATATATAAATATATTCATAAAATTCATCATGAGTTTCAGGCTCCATTTGGAATGGAAGCTGAATATGCACATCCCCTTGAAACGCTAATTCTTGGAACTGGATTTTTCATTGGAATTGTTCTTTTATGTGATCATGTAGTTCTTCTTTGGGCATGGGTGACCATTCGTTTGCTAGAAACTATCGATGTCCACAGTGGTTATGATATTCCTCTCAACCCTCTAAATCTCATCCCATTCTATGCTGGTTCTCGACATCACGATTTTCACCACATGAACTTCATTGGAAACTATGCTTCAACATTCACGTGGTGGGATAGAATTTTTGGAACAGACTCTCAATTTATTGCCTACACTGAAAAGATGAAGAAGATTAAGAAAAAGGCTGAATAAATATCTATGTAAACCTTCCTGAAGAAACACATTTTCCTGGATTAAAAGTAGTAGCTAACATTGCTTCTGGGGAGCAGAAACAAACATGTCTTGGCTGCTAAGTGATGGAAAAAAATTAACAACCTTTATCTTCCTAGTGGGAACTTTTTCTATTTTCCATTCAAGTTCTGTATGTGTAGAAATAAGAAAGGAAGTTTTAAAGGCCGTGTTGCTAACTTTACAAAAAGATTTGTGTAAAGTAAATGGAAAAAGGATTAACCTGTCTGTCCCTACCATTAATACTATAGACCTGAAGTTGAAGTTGGTCTTTAAATCTTAGTGGCCATTTTAACAACTTTTATTAGTGAATGTTGACCTCATCTTGAACTTTAAACGTTTTTTAGAATTTGCCTAAAGATCAAAATATGGGATGAATGACATCAGTTGATACGATGTGAGTGGGGCTGCAAAATCAGGAATAGCCAACACCAAGAATTTCTACTCTTGTCTGGAGCTGACCGATTTGGGGTGATTTTCTTTGAGAAGTCCTTTTGGGTCCCTACTATTGACATCTATAAATTAAAGCAAATCTGAATCGATGTAAGTGGAATATTTTAGTCTAAAGGTTTTCAGGTTTCTTGAATTTTAAATAAATAAATAAATAAACCTTTATTTCTGCCACTTACTGTTTAATATTTGAAAATCAGGTTTTTATTATACTTAAAACTGTATCTTAAAATTTTGTGAACCTACTTGGTGTATTTGCACTTTGAGCTACTGAAATAAATGTGATTTTTTTGCGTCTGGTTATCTGGTCTCCAATTTTGAACATCAG