Transcript asmbl_47376

Sequence
Transcript Sequence for observation asmbl_47376 of TGE0005590:
AGCTAACTGTGTGCGCCCCAGCCGCGCGCAGCTACTCGCGTCCGAGCCTCGCGCAAGCTCTCGTGTGTGCCGTGTCGTTTGGCGTCCACCTACCCCTCCGCTCTCCTTGCAAGTACCCCGCGCGTCTGCCACGCAGTCATGTCGTCCGGCAGCCGCGTTGCGCTGGTGACCGGCGCCAACAAGGGCATCGGCCTTGCCATTGTGCGCGACCTGTGCCGGCAGTTCTCCGGGGACGTGGTGCTCACAGCGCGGGACGCGGCGCGGGGCCAGGCAGCCGTGCAGCAGCTGCAGGCCGAGGGCCTGAGCCCGCGCTTCCACCAGCTGGACATCGACGACCTGCAGAGCATCCGCGCCCTGCGCGACTTTCTGCGCAAGGAGTACGGGGGCCTGGACGTGCTGGTCAACAACGCCGGCATCGCCTTCAAGTTAAAGGATCCCACACCGTTTCATATACAAGCAGAAGTGACAATGAAAACAAACTTTTTTGGTACCCGAGATGTCTCCACGGAACTACTGCCTCTCATGAAACCCCAAGGCAGAGTGGTGAATGTGTCCAGCAGCGTAAGCCTCACTGCTCTCAGGAGCTGCAGCCCAGAGCTGCAGCAGCAGTTTAGAAGCGAGACCATCAGTGAGGAGGAGCTGGTGGGGCTCATGAACAAGTTCGTGGAAGATGCGAAGAACGGTGTGCACCAGGAGGCGGGCTGGCCTACTAACGCCTACGGAGTGACGAAAATCGGTGTCACGGTCCTGTCCAGAATCCAGGCCAGGAACCTGAGCACGCAGAGGAAAGGGGACAAGATCCTCCTGAATGCCTGCTGTCCAGGGTGGGTGAGAACTGACATGGCGGGATCCAGAGCCCCCAAAAGCCCGGAGGAAGGCGCAGAAACCCCCGTGTACTTGGCCCTTTTGCCCTCGGATGCTACAGAGCCTCATGGGCAGTTTGTTAAGGAGAAAAAAGTTGAACAGTGGTGAGTGAGCTCAACCCATAGAGCTCCATCCATAGTTTCCATGTTGTACCCGTCCTGATTTGATCCAAAGTGTGTTTAACACAGTCAAAACTATCCCTACCAAGGATTCACTTTGAATTGTCTACCAATTCTATGAAGCCTTTTGTAATTTGTGATGTTTATGCAGTTCTCTGTGATATTCTATAGGGAGAACACATGTGTTAGTGCTGATAATAACGAATTAAAATCAATAGAGG