Transcript asmbl_45908

Sequence
Transcript Sequence for observation asmbl_45908 of TGE0005501:
GGGACTCTATCTGGGACTCAATATTCGGGTGAAAAAGACCCGGGATTCAGTTGAGACGTCTACTGCTGCTTTTGCGTACACTTTCAGGGTGTACCGTCCTCCATCTCCACTGTTTGCCTCTCTCTCCTGTTCCTGTTCCAATCAAGGTATTTTGTCTTGAGCCACCTCCCACCTCTTTATCGAGAAGTGTCACCAGAACCATGGCTGAATACTCCTATGTGAAGTCCACCAAACTCGTGCTCAAAGGAACCAAAGCTAAGAGTAAGAAGAAAAAGAGCAAAGAGAAGAAGAGAAAAAGAGAAGATGATGAAGAAACCCAACTTGATATTGTTGGAATTTGGTGGACAGTAACAAACTTCGGTGAAATTTCAGGAACCATAGCAATTGAAATGGATAAAGGAACCTACATACATGCCCTTGACAATGGACTTTTTACACTGGGAGCTCCACATAAAGAAGTTGATGAAGGCCCTAGTCCTCCAGAGCAGTTTACAGCTGTCAAATTGTCTGATTCTAGAATTGCCCTGAAATCTGGCTATGGAAAATACCTTGGTATAAATTCAGATGGACTTGTTGTTGGGCGTTCAGATGCAATTGGACCAAGAGAACAATGGGAACCGGTCTTTCAAGATGGGAAAATGGCTTTATTGGCCTCAAATAGTTGCTTTATTAGATGCAATGAAGCAGGTGATATAGAAGCAAAAAGTAAAACAGCAGGAGAAGAAGAAATGATAAAGATTAGATCCTGTGCTGAAAGAGAAACTAAGAAAAAAGATGATATTCCTGAAGAAGACAAAGGAAATGTTAAACAGTGTGAAATCAATTATGTGAAGAAATTTCAAAGCTTCCAAGACCACAAACTTAAAATAAGTAAAGAAGACAGTAAAATTCTTAAAAAGGCCCGGAAAGATGGATTTTTGCATGAAACACTTCTGGATAGGAGAGCCAAATTGAAAGCTGATAGATACTGCAAATGACCAGGATTTTTATGGGTTTTTTTCTTTCTTT