Transcript asmbl_17479

Sequence
Transcript Sequence for observation asmbl_17479 of TGE0003958:
CACTTTTGAGGGGGGAGGGGCATTCGGAGGAAGCACGGGCCCGGCGGAGGTCATGTTTGTGGCACGCAGCATAGCGGCGGACCATAAGGATCTTATTCATGATGTTTCTTTCGACTTTCACGGGCGGCGGATGGCGACTTGTTCCAGCGACCAGAGTGTCAAGGTTAAGAGGACAACTCTAGTGGATAGCAGAACATCCGTTACCGATGTGAAATTTGCTCCTAAGCATATGGGTCTTATGTTAGCAACCTGCTCAGCAGATGGTATAGTAAGAATATATGAGGCACCAGATGTCATGAATCTCAGCCAGTGGTCTCTGCAGCATGAGATATCATGTAAGCTAAGCTGTAGTTGTATTTCTTGGAACCCTTCAAGCTCTCGTGCTCATTCCCCCATGATAGCTGTAGGAAGTGATGATAGTAGTCCAAATGCAATGGCCAAGGTTCAGATTTTCGAATATAATGAAAACACCAGGAAATATGCAAAAGCTGAAACCCTCATGACAGTTACAGATCCTGTCCATGATATTGCATTTGCTCCAAACCTGGGAAGGTCTTACCATATTCTGGCCATAGCAACCAAAGATGTGAGAATTTTTACATTAAAGCCTGTGAGGAAAGAACTTACTTCCTCTGGTGGGCCAACAAAATTTGAAATCCATATAGTGGCTCAGTTTGATAATCATAATTCTCAGGTCTGGCGAGTGAGTTGGAATATAACAGGAACAGTGCTAGCATCTTCAGGCGATGATGGCTGTGTAAGATTGTGGAAAGCTAATTATATGGACAATTGGAAGTGTACTGGTATTTTGAAAGGTAATGGGAGCCCTGTCAGTGGGAGTTCTCAGCAGGGAAACTCAAATCCTTCCCTAGGTTCAAATATCCCAAATCTTCAAAATTCATCAAATGGATCTTCTGTTGGCAGAAAGCACAGCTGAGTACCAGCTAACTGGAGTAACTTTGCTGTTTTGCTGCTTGTTGCATGCACACAGGAATGGAGAGCGAGCTCCTTTTCCCCTTCCCCAGCGCCATTTGACCTCTCCCAAGATACACCAGCAGCCTGCTTACTACTAAACGCAATCCAAAAGGCCTTTAAAAATACAATGTATATCATTTTTTTGTACTAGCCAGTCTATTGACACTATTTGAAACCTTTGAAAATATAAATGGAGAGGCTTTTTGT