Transcript asmbl_44426

Sequence
Transcript Sequence for observation asmbl_44426 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGTGAGTCTGGGCAGCTCCCGCTCAGGTCCCGTGAGCTTTCAGGGCTG