Transcript asmbl_44425

Sequence
Transcript Sequence for observation asmbl_44425 of TGE0005438:
GCAGACTTGCCAGTGCCCCAGGTGAACGAGCAGAGGGACCTGGACCCCGGTCGGATGCAGATGCTGCAGGGGAACCCGCTGCTGCTCCCACACAGCCTGCAGGAGCTGCTGGCCAAGGACACCGTGCAAGTGGCCCTCGTCCCCGAGAGGAAGGGCCTCTTCCTGAAGCATGTGGAGTACGAAGTGTCCAGCCAGCGCTTCGGGGCCTCCGTGAGCCGCCGGTACAACGACTTCGTGGTTTTCCACGACCTGCTGCTCCAGAAGTTCCCCTACCGCATGGTGCCGGCCCTGCCGCCCAAGAAGATGCTGGGAGCTGACAGGGAGTTCATCGAAGCCCGGAGGAGAGCCCTGAAGCGCTTCATTAACCTGGTGGCCCGGCACCCCCCCTTCTCCGAGGACGTGGTGCTCAAGCTGTTCCTGTCCTTCAGCGGCCCCGACGTGCAGAGCAAGCTAAAGGAATCGGCTCAGTGTATGGGAGACGAATTCACGAACTGTAAGCTGGCGACGCGGGCCAAGGACTTCCTCCCAGCTGACATCCAGACTCAGTTCGCAGTTAGCCGGGAGCTGATCCGAAATGTCTACAACAGCTTTTACAAGCTTCGTGATCGGGCCGAGAGGATTGCGTCAAGGGCCATCGACAATGCTGCTGACCTCCTCATATTCGGGAAGGAGCTAAGTGCTTTAGGGTCTGACACGACACCGCTCCCCTCCTGGGCCGCTCTGCACAGCAGCACGTGGGGGTCCCTCAAACAGGCGCTGAAAGGGCTCTCTGTTGAGTTTGCACTGCTCGCTGACAAGGCCGCCCAGCAGGGCAAAAAGGAAGAGAACGATGTGGTGGAGAAGTTGAACCTCTTCCTGGATCTGCTCCAGTCCTACAAGGACCTGTGCGAGCGGCACGAGAAGGGCGTGCTGCACAAGCACCAGCGGGCGCTGCACAAGTACAGCCTGATGCGGAGGCAGATGAGCGCGGCCGTGCACGGCCAGCAGCCCGAGGCCGTGCAGCAGCTGGAGTCGCGCATCGTGGAGCAGGAGAGCACGATCCAGACGATGGAGCTGCGGCACGCCTTCTCCCTGTACTGCCTGCACCAGGAGACGCAGCTGGTCCACGCCCACCTGCCCCTCACCTCCCACATCCTCGGGGCCTTCGTCAACTCCCAGATCCAAGGGCACAAGGAGATGAGCAAGGTGTGGGACGACCTGAAGCCCAAGCTGCACTGCCTCTTCGCTGGACCCAACAGCACCTGACCCTGCCAGGGTCCCCAGGGATGGCCTGTCTCCTCACTAGTGCTGCGAGGACCCGGGGCGCAAAACCCACCGGCGCCCTCACTAAAACTTCTTTCCAAACGGTGTGTCCCTGTTTGATTCCCTTCAGAGAGCAGCTGTCCCCCATGTCCCGCGGGCTGCCGCCCTCAAGCAGGAGAGCTGACGTCAGGGCTGGCAGGTCCGGTGCGACGGCGCAGAGCCGAGGACACGGCTGTGGGCTCAGGCTGTGGCCGTCCTGGCCCAGCGCTGTGGCCTGAGGCTTGTGCTGGAAAGCGTCGGCCCCTGGGATGGCTTCCCCTGGGACCTGGAGGCCAGCGTGCGGCAGAGGTTTTCACAGCACACGGTGCCCGGGGGGTGCAGGGGCCCTGTGCTGGAGCAGCCGGAGAGGGAGGCCGAAACCCTGTGGAGGGCAGGAATGTCCCTGCGGTGGCATGTCACCCTGGATGAGGCACAACTGAT