Transcript asmbl_439

Sequence
Transcript Sequence for observation asmbl_439 of TGE0012341:
CGCGCGTGGAGACTACTCACCGCGCGGTCAGCTCGGCAGCGGGGCCAGGCGGTGAGGCGGCACGTGGCGCTCGCGAGCCATGTCGTGGCTCTTCGGCATCAAAGGCTCCAAAGGCGAAGGCACGGGACCGCCGCTTTCCCTGCCGCCCGTGCAGCCTGGGGCCGAGGGCGGCGGGGATCGCGGCGCGGGAGACCGGCCGGGGCCCAAGGACAAATGGAGCAACTTCGACCCGACGGGCCTGGAGCGCGCAGCCAAGGCGGCGCGCGAGCTGGAGCACTCGCGACACGCCAAGGAGGCGCTGAGCCTGGCGCAGATGCAGGAGCAGACGCTGCAGCTGGAGCAGCAGTCCAAGCTCAAAGAGTACGAGGCCGCCGTGGAGCAGCTGAAGAGCGAGCAGATCCGCGTGCAGGCTGAGGAGCGGCGGAAGACCCTGAGCGAGGAGACGCGGCAGCACCAGGCCAGGGCCCAGTACCAGGACAAGCTGGCCCGGCAGCGCTACGAGGACCAGCTGAAGCAGCAGCAACTTCTCAACGAGGAGAATTTACGGAAGCAGGAGGAGTCTGTGCAGAAGCAGGAGGCCATGAGGCGAGCCACCGTGGAGCGAGAGATGGAGCTGCGGCACAAGAACGAGATGCTGCGGGTGGAGGCCGAGGCGCGTGCCCGGGCCAAGGCCGAGCGCGAGAATGCAGACATCATCCGCGAGCAGATCCGCCTGAAGGCTGCTGAGCACCGCCAGACCATCCTGGAGTCCATCCGGACGGCTGGCACCTTGTTTGGTGAAGGATTCCGTGCCTTTGTGACAGACTGGGACAAAGTGACCGCCACGGTAGCCGGGCTGACGCTGCTGGCTGTCGGGGTCTATTCTGCGAAGAACGCCACATCGGTCGCAGGGCGGTACATCGAGGCCCGGCTGGGGAGGCCGTCCCTGGTGAGGGAGACCTCGCGGATCTCGGTGCTGGAGGCTCTGTGGCACCCCCTGCAGGTCAGCAGGCGGCTGCTCAGCAAGCCTCAGGACGCCCTGGAGGGTGTTGTCCTCAGTCCCAGCCTGGAGGCGCGTGTGCGGGACATCGCCATTGCGACAAGGAACACCAAGAAGAACCGCAGCCTGTACAGGAACATCCTCATGTACGGGCCGCCCGGGACGGGCAAGACGCTGTTTGCCAAGAAACTGGCGCTGCACTCGGGTATGGACTATGCCATCATGACCGGCGGGGACGTGGCCCCCATGGGGCGAGACGGCGTGACCGCTGTGCACAAGGTCTTCGACTGGGCCAGCACCAGCCGGCGAGGGTGAGCCTCCGAGAGCCTCCTCCTCTTCGTGGACGAAGCGGACGCCTTCCTCAGGAAGCGAGCCACCGAGAAGATAAGCGAGGACCTCAGGGCCACCCTGAACGCGTTCCTGCACCGGACGGGCCAGCACAGCAGCAAGTTCATGCTGGTCCTGGCCAGCAACCAGCCCGAGCAGTTCGACTGGGCCATCAACGACCGCATAGACGAGATGGTCAGCTTCGACCTGCCACGGCTGGAGGAGCGGGAGCGCCTGGTGAGAATGTATTTCGACAAGTACGTTCTGAAACCAGCCACAGAAGGGAAGCAGCGCTTGAAGCTGGCTCAGTTTGACTACGGGACGAAGTGCTCGGAGGTCGCGCAGCTGACGGAGGGCATGTCGGGCCGGGAGATATCCCAGCTGGCCGTGGCGTGGCAGGCCATGGCCTATGCCTCCGAGGACGGTGTCCTCACCGAGGCCATGATGGACGCCCGAGTCCAGGACGCCATCCGGCAGCACCAGCAGAAGATGCAGTGGCTGAAGGCCGAGGGACCCGGGCCCGGCAGTGGCCAGCCCCTCCTCCTGAGTGCACGGACCAAGTGAGCTGGGCCTCGACAGCTGGGGACCCTGGGGCACACCCGCTTGGTGGCTTCGCCAGAGGAAACACCAAGGCGCCCGCGTCTCCTGGCGGCCAGCAGGGGGCTCTGCAGCCGCCCACCTCCCGGCAGTTTTTAATATTCCTCCGCTCAGGGCCAGGGCAGCATTAAAGGCCTCTACTTAGGACCAGCTGCGGCTGTGGCGTCTTTGTGGGGGGGAATCTGCCCCTCCAGGCTGTGGTTTTGGCTGGGGAGGGTCAGGCTGGGGCTACCCCCAGGACACTCCTAGGGGACGTGTCTCCAAGCCAGGCCCAGAGCGGGAAGAAGGCACAGCCCCCCGGTCCAGGGGTAGCTGAGAGCTGGCTGCTGCAGTGGGGGCGTCTAGCCAGGGGAAGGCCTGGCACAGTCGGGGATCCGTGAGGGGTGAGCAGAGCAGGCCCGTGCTGCCCGTCAGAGCTGCCCGCCTCTGCACTGGGGAAGAGGAGGTACCCTGTACACATCTGTGCCTGCCCTGGTGGGGGCCACACCGGGACTGGACACCTGACCTGACCAGGGTCGTCGGTGCTGGGGGCTGCCCAGGGGAGCCCCACTCTCCCTGGGTTGAGCTGGGGTCTCCAGAATCCAAT