Transcript asmbl_17204

Sequence
Transcript Sequence for observation asmbl_17204 of TGE0000401:
GGCTGGCCGAACACAAGCCCCTGGTCTTGTGTGGCCCTCCTGGGTCTGGCAAGACCATGACACTCTTCAGCGCCCTCCGGGCCTTGCCTGACATGGAGGTGGTGGGTCTCAACTTCTCCAGTGCTACTACTCCAGAGCTGCTTCTGAAGACTTTTGATCACTACTGCGAGTACAGGCGCACACCTAATGGGGTGGTTTTGGCTCCTGTTCAACTTGGAAAGTGGCTGGTGTTGTTCTGTGATGAAATCAACTTGCCAGATATGGATAAATATGGGACCCAGAGGGTCATATCCTTCATCAGACAGATGGTGGAGCACGGAGGCTTTTACCGTACCTCAGATCAAACATGGGTGAAGCTGGAGAGAATCCAGTTTGTTGGGGCTTGTAATCCCCCCACAGACCCTGGAAGAAAGCCCCTCTCACACAGGTTCCTGCGCCACGTGCCTGTCGTGTATGTGGATTACCCGGGCCCCGCCTCCCTCACACAGATCTACGGCACCTTCAACCGCGCCATGCTGAGGCTCATTCCATCCCTGCGGACGTATGCAGAGCCGCTCACTGCTGCCATGGTGGAGTTCTACACCATGTCTCAGGAGAGATTCACCCAGGATACACAACCTCACTATATCTATTCACCCCGTGAAATGACTAGGTGGGTGAGAGGCATCTTTGAAGCGCTGAGACCTCTGGAGACCCTGCCTGTTGAAGGCCTCATTCGGATTTGGGCACATGAAGCTCTGCGTCTCTTCCAAGATAGACTCGTAGAGGATGAGGAGAGGCGTTGGACTGATGAGAACATCGACACGGTTGCTCTGAAGCACTTCCCTAACATCGACAGAGAGAAGGCAATGAGCCGACCCATCTTGTACAGCAACTGGCTGTCAAAGGATTACATCCCAGTAGACCAAGAAGAGTTAAGAGATTATGTCAAAGCTAGGCTGAAGGTCTTTTATGAAGAAGAACTTGATGTTCCGCTGGTGCTGTTTAATGAAGTCCTAGACCACGTGCTGAGGATTGACAGAATATTCCGTCAACCTCAAGGCCACTTGCTTCTGATTGGTGTTAGTGGAGCAGGAAAAACTACCCTGTCTCGTTTCGTCGCCTGGATGAACGGTTTGAGTGTGTACCAGATTAAGGTCCATAGGAAGTACACAGGGGAAGACTTTGATGAAGATCTACGGACAGTGTTGAGACGTTCTGGCTGTAAAAATGAAAAGATAGCATTTATAATGGATGAATCTAATGTGTTAGATTCTGGATTCCTGGAGCGAATGAATACCCTTCTGGCCAATGGAGAGGTGCCTGGTCTCTTTGAAGGAGACGAGTATGCCACCTTGATGACGCAGTGCAAAGAGGGGGCACAGAAGGAAGGCCTGATGCTGGACTCGCACGAGGAGCTCTACAAGTGGTTCACTAGCCAGGTTATCCGCAACCTCCACGTCGTGTTCACCATGAACCCGTCCTCGGAGGGACTCAAGGACCGGGCAGCTACATCACCAGCACTTTTCAACAGGTGTGTGTTGAATTGGTTTGGAGACTGGTCCACCGAAGCACTGTATCAGGTTGGCAAAGAATTCACAAGTAAGATGGATCTGGAGAAGCCAAATTACATCGTGCCTGATTACATGCCAGTTGTGTATGATAAGCTGCCGCAGCCACCATCCCATCGGGAAGCCATTGTGAACAGCTGTGTGTTTGTTCATCAGACTCTTCACCAGGCGAATGCTCGGCTAGCAAAGCGAGGCGGCAGAACGATGGCCATCACCCCTCGCCACTACCTGGACTTCATCAATCACTATGCCAACCTGTTCCACGAGAAGCGGAGCGAGCTGGAGGAGCAGCAGATGCACTTGAACGTGGGGCTCAGGAAGATCAAAGAGACAGTCGACCAGGTAGAAGAACTGCGTCGTGACTTGAGGATAAAGAGCCAAGAGCTGGAGGTGAAGAATGCAGCAGCCAATGACAAGCTGAAAAAGATGGTGAAAGACCAGCAGGAGGCTGAAAAGAAGAAGGTTATGAGCCAAGAAATCCAGGAACAGCTGCATAAGCAGCAGGAGGTAATTGCAGACAAACAGATGAGTGTCAAAGAAGATCTTGATAAGGTGGAACCTGCCGTCATTGAGGCCCAGAATGCTGTGAAGTCGATCAAGAAGCAGCACCTGGTGGAGGTGAGGTCCATGGCCAACCCTCCTGCTGCTGTGAAGCTGGCGCTGGAGTCCATCTGCCTGCTGCTGGGGGAAAGCACCACAGACTGGAAGCAGATCCGCTCCATCATCATGCGGGAGAACTTCATCCCCACCATCGTCAACTTCTCTGCAGAGGAGATCAGTGACGCCATAAGGGAGAAGATGAAGAAAAATTACATGTCCAATCCAAGTTACAATTATGAAATTGTGAATCGGGCTTCCCTGGCTTGCGGCCCTATGGTGAAATGGGCAATTGCACAGCTTAACTATGCAGACATGTTAAAGAGAGTGGAGCCCCTACGCAATGAGCTGCAGAAGCTGGAAGATGACGCCAAGGACAACCAGCAGAAGGCCAACGAGGTGGAGCAGATGATCCGAGACCTGGAAGCCAGCATCGCCCGCTACAAGGAGGAATACGCCGTCCTGATCTCAGAGGCCCAGGCCATCAAGGCAGACCTGGCAGCTGTCGAGGCAAAAGTAAACCGGAGCACTGCTCTTCTGAAGAGCTTGTCTGCTGAACGTGAACGATGGGAAAAAACAAGTGAAACTTTCAAAAACCAGATGTCCACCATTGCTGGGGACTGTCTCTTGTCAGCTGCGTTCATTGCCTACGCGGGTTACTTTGACCAGCAGATGCGTCAGAACTTGTTCACTACCTGGTCCCATCACCTACAGCAAGCCAACATCCAGTTCCGTACAGATATTGCCAGGACGGAATACCTTTCCAATGCTGATGAGCGTCTTCGCTGGCAGGCCAGCTCCTTGCCTGCTGATGACCTTTGCACAGAAAATGCCATCATGCTGAAACGATTCAATAGGTATCCGCTGATCATTGACCCCTCTGGACAGGCCACAGAATTCATTATGAATGAATATAAGGATCGTAAGATCACACGGACCAGCTTCCTGGATGACGCCTTCAGAAAGAACTTAGAGAGTGCACTGAGATTCGGTAACCCCCTTCTGGTCCAGGATGTGGAAAGCTACGATCCAGTTTTGAACCCGGTGCTGAACCGTGAAGTGCGGCGAACAGGGGGGAGAGTGCTGATCACTCTCGGGGACCAGGACATAGACCTGTCGCCATCGTTTGTCATCTTCCTGTCCACCCGGGATCCAACTGTCGAGTTCCCACCAGATCTCTGTTCCCGGGTTACTTTTGTAAACTTCACAGTTACCCGTAGCAGTTTACAAAGCCAGTGTCTAAATGAAGTACTTAAAGCAGAAAGACCTGATGTGGACGAGAAACGATCTGATCTTCTTAAACTTCAAGGGGAATTTCAGCTCCGTTTGCGTCAGCTGGAAAAATCTCTACTACAAGCTCTGAACGAGGTGAAAGGGCGCATTTTGGATGACGACACGATCATAACCACTCTGGAGAACCTGAAGAGAGAGGCTGCAGAGGTCACCAGGAAAGTTGAGGAGACGGACATTGTCATGCAGGAGGTGGAGACCGTGTCCCAGCAGTACCTCCCGCTCTCCACCGCCTGCAGCAGCATCTACTTCACCATGGAGTCCCTCAAGCAGATACACTTCTTGTACCAGTACTCCCTCCAGTTTTTCCTGGACATTTATCACAACGTCCTATACGAGAACCCGAACCTGAAGGGTGTCACCGACCACACACAGCGCCTGTCCATTATAACAAAGGACCTCTTCCAGGTGGCGTTTAACCGAGTGGCTCGAGGCATGCTGCATCAGGACCACATTACCTTTGCCATGCTGCTGGCAAGAATCAAACTGAAGGGCACCGTGGGGGAGCCCACCTACGATGCAGAATTCCAGCACTTCTTGAGAGGAAATGAGATTGTCCTGAGTGCTGGCTCCACCCCCAGGATCCAGGGCCTGACTGTGGAGCAGGCGGAGGCGGTGGTGAGGCTGAGCTGCCTTCCCGCGTTTAAGGACTTGATTGCAAAGGTTCAGGCAGACGAGCAATTTGGCATCTGGCTGGACAGCAGCTCCCCGGAGCAGACTGTGCCCTACCTCTGGAGTGAAGAAACACCTGCAACACCCATTGGCCAGGCCATCCACCGCCTGCTCCTGATCCAGGCTTTCCGGCCCGATCGCCTGTTGGCCATGGCCCACATGTTTGTTTCAACAAACCTTGGGGAGTCTTTCATGTCCATCATGGAGCAGCCGCTCGACCTGACCCACATTGTGGGCACAGAGGTGAAGCCCAACACTCCTGTCTTAATGTGCTCTGTGCCTGGTTATGATGCCAGTGGACATGTCGAGGACCTTGCAGCCGAGCAGAACACGCAGATCACTTCAATTGCAATCGGCTCTGCAGAAGGCTTTAACCAAGCAGATAAGGCAATAAACACCGCTGTAAAGTCGGGCAGGTGGGTGATGCTGAAGAATGTGCATCTGGCCCCAGGGTGGCTGATGCAGCTGGAGAAGAAGTTGCATTCCCTGCAGCCGCATGCCTGCTTCCGACTCTTCCTCACCATGGAGATCAACCCCAAGGTGCCTGTGAATCTGCTCCGTGCGGGCCGCATCTTTGTGTTCGAGCCACCGCCAGGGGTGAAGGCCAACATGCTGAGGACGTTCAGCAGCATTCCCGTCTCACGGATATGCAAGTCTCCCAACGAGCGTGCCCGCTTGTACTTCCTGCTGGCCTGGTTTCATGCGATCATCCAAGAACGCTTACGATACGCACCACTGGGGTGGTCAAAGAAGTATGAATTTGGAGAGTCTGACCTGCGGTCAGCTTGCGATACGGTGGACACGTGGCTGGATGACACGGCCAAGGGCAGGCAGAACATCTCACCGGATAAGATCCCGTGGTCTGCACTAAAGACCTTAATGGCCCAGTCCATTTATGGCGGGCGCGTGGACAACGAGTTTGACCAGCGTCTGCTCAACACCTTCCTGGAGCGCCTGTTCACAACCAGGAGTTTCGACAGTGAGTTTAAGCTGGCATGCAAGGTCGACGGACATAAAGACATTCAAATGCCAGATGGCATCAGGCGAGAGGAGTTTGTGCAGTGGGTGGAGTTGCTCCCCGACACCCAGACGCCCTCCTGGCTGGGCCTGCCCAACAACGCCGAGAGAGTCCTCCTTACCACACAGGGTGTGGACATGATCAGTAAAATGCTGAAGATGCAGATGTTGGAGGATGAGGACGACCTGGCCTACGCAGAGACTGAGAAGAAGACGAGGACAGACTCCACGTCCGACGGGCGCCCTGCCTGGATGCGGACACTGCACACCACCGCGTCCAACTGGCTGCACCTCATCCCCCAGACGCTGAGCCACCTCAAGCGCACCGTGGAGAATATCAAGGATCCTTTGTTCAGGTTCTTTGAGAGAGAAGTGAAGATGGGCGCAAAGCTGCTTCAGGACGTTCGCCAGGACCTTGCAGATGTCGTCCAGGTGTGCGAAGGAAAGAAGAAGCAGACCAACTACTTGCGCACGCTGATCAACGAGCTAGTGAAAGGGATCTTGCCTCGGAGCTGGTCCCACTACACGGTGCCTGCCGGCATGACCGTCATCCAGTGGGTGTCCGACTTCAGCGAGAGGATCAAACAGCTGCAGAACATCTCACTGGCAGCTGCATCTGGTGGCGCCAAGGAGCTAAAGAACATCCACGTGTGCCTGGGTGGCCTGTTCGTGCCTGAGGCGTACATCACTGCCACCAGGCAGTATGTGGCCCAGGCCAACAGCTGGTCCCTGGAGGAGCTCTGCCTGGAAGTCAACGTCACCACCTCACAGGGCGCCACCCTTGACGCTTGCAGCTTCGGAGTCACGGGTTTGAAACTTCAAGGGGCCACGTGCAACAACAACAAGCTGTCACTGTCCAATGCCATCTCAACCGCCCTTCCCCTGACGCAGCTGCGCTGGGTCAAGCAGACAAACACCGAGAAGAAGGCCAGTGTGGTAACCTTACCTGTCTACCTGAACTTCACCCGTGCAGACCTCATCTTCACCGTGGACTTCGAAATTGCTACAAAGGAGGATCCTCGCAGCTTCTACGAGCGGGGTGTCGCAGTCTTGTGCACAGAGTAAACTTTTCTAGCTGCCCCTTTCTGTAATAGTGAAAGTTGGTATTTAACATTTATTCATTTTTAAAATATTTGGAAGGTCTGAGCTTGTGAAAAGAAAGTGGTTGGTCTGAGGTTGGAGGAAGCTGAATGGAATCTGACGGTTGGGAGTGGTGGAAATTGGAAGGATACCAGGAGGTATTTGGGAAGGCCAATGGCGTGGCTCCTTTGAGGAAATAAAACACTAAGCATGAGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCATCCCAGG