Transcript asmbl_43739

Sequence
Transcript Sequence for observation asmbl_43739 of TGE0005387:
ATAGCGAACTTGGTAGGGTTGCACGCGGGTTCAAGTTGTTGTTGGGGTTCTTTTGTGCCAGGGGGCTCTACGAGCTTGGGGCCCCGTTACTACTTTGTCAGTGGGTGCAATGGCGCTTCTCCGGGGTATGTGGGGCGTGCTAAGTGCACTGGGAACGTCCGGAGCTGCTCTCTGCGCAGACTGTGGGAGTCGACTGCGCTCTCCCTTCAGTTTTGCGTATATACCGAGATGGTTTTCATCCGCCTTGATTAGTTATCCAAAGAAGCCTATGACTTCATATGTTCGATTTTCTAAAGAACAGCTACCCATTTTTAAAGCTCAGAACCCAGATGCGAAAAATTCAGAACTAATTAAAAAAATCGCCGAGCTATGGAGGGAACTTCCTGAGTCAGAAAAAAAAGTATATGAAGATGCTTATAAGGCAGACTGGCAGGCATACAAAGAGGAGATAAACAGAATTCAAGAACAGCTAACTCCAAGTCAGATGGTATCTTTGGAAAAAGAAATCATGCAAAAACGTTTAAAAAAGAAAGCAATAATAAAAAAGAGAGAGTTAACAATGCTTGGAAAACCGAAAAGACCTCGCTCAGCTTATAACATTTTTATATCTGAACGCTTCCAGGAAGCTAAGGATGGTACATCACAGTTAAAGCTGAAGACTGTAAATGAAAGCTGGAAAAATCTCTCTAGTTCTCAAAAGCAAGTATATATCCAACTTGCTGAAGATGATAAAATTCGTTATTATAATGAAATCAAATCTTGGGAAGAACAAATGGTTGAAGTTGGACGAATTGATCTTCTCCGTCGCAAAATGAAGCCCCAAGCAAAAAGCACTGAGAAGTGTTAAATAGAAGATTGAGTTATGTTCATAGTGGATAGATACAAGAAACCAATTAGGTCTCAATACCTGAAGCCGTTGTTAAATTAGAAAGGATAAAGTTGGTAAACATTTTATACTTAATTCCTTTTTCTTTAGCCCATGGACTTCTGCCAGTTCAATACATTTTGTATGAGTATCTTGCTTTGGAAAACCCAAACAGATAAAAAATTCACTTGAAATTTATTTTGCGTTTAGGAACTACTAAGGGTTAAAATAATCCATGAAATGTATCAATGATCATTTTACCTTTGATAAAGGTGAATCAGACTGTGAAGTTTTTTTATACTTGTTGACTGGGAAGAGTATTCTTGTTTCCTTATATTATGGAGGCAGGGGTTTCATATTCAAAAGTGTCCCAAATTGTAGAGCCATAATGTTCTGTGATATAATTGTGCATTGTTTAAAAGAGCACCAGGAACTCATCTAGGTAAATTCCAATTCCTAGGCATCATTCACATTATATTCAGATTTGGTGGTAATGCAAGGGATTGCTGGTTTCGGTTACAACTTTTTGTATAAAGGATAGAGAGATTTATAAACCTTTTTCTCATTGCCTTTTTTCATAAATTAAAAACTAAGAAA