Transcript asmbl_43543

Sequence
Transcript Sequence for observation asmbl_43543 of TGE0005343:
AGTGGGCGGAGCGCGGGTGGAGTGGGCAAGCGAGCGCGAGCAGTGTTAAAGGGAGCTCCCGGCACCGCTCGCAGGTCCAGTTTCCGCAGTGCGCACGCGCAAGGGTATCTTGTCAGTCGGCGCCGCGTGCGGGCCGGTGGCTCTGTAGCAGCGGCGGCGGCTAGTCTCCGGCACCATGAGCGGCTTCAGCAGCGAGGAGCGCGCCGTGCCCTTCACCCTCGAGTACCGAGTCTTCCTAAAAAATGAAAACGGACAATATATATCTCCATTTCATGATATTCCAATTTATGCAGATAAGGATGCGTTCCACATGGTAGTTGAAGTACCACGCTGGTCCAATGCAAAAATGGAGATTGCTACAAAGGACCCTTTAAACCCAATTAAACAAGATGTGAAAAAAGGAAAACTTCGTTATGTTGCAAATTTGTTCCCTTATAAAGGATATATCTGGAACTATGGTGCCATCCCTCAGACTTGGGAATACCCAGGACACAATGACAAACACACTGGCTGTTGTGGCGATAACGACCCAATTGATGTGTGTGAAATTGGAAGCAAGGTATGTGCAAGAGGTGAAATAATCAGGGTGAAAGTTCTAGGCATATTGGCTATGATCGATGAAGGGGAAACTGACTGGAAAGTCATTGCCATTAATGTGGATGATCCTGATGCAGCCAATTATAATGATATTAATGATGTCAAGAGGCTGAAACCTGGCTACCTTGAAGCTACAGTGGACTGGTTTAGAAGGTACAAGGTTCCTGATGGAAAACCAGAGAACCAGTTTGCTTTCAATGCAGAATTTAAAGATAAGGACTTTGCAGTTGATATTATTAAAAGCACTCATGACCTTTGGAGAGCCTTAGTGACGAAGAAAATTGATGGAAAAGGAATCAGTTGCATGAACACCACAGTGTCTGAGAGCCCCTACAAGTGTGATCCTGAGGTGGCCAAAGCCATTGTGGATGCTTTACCACCACCATGTGAATCTGCCTGCACAGTACCAACAGATGTAGATAAGTGGTTCCATCACCAGAAAAACTAAGGAAATTTCTCTGGAATACAAGCTGATACTGCAGCATCCTATTCATCTGGGAGTATTAGATGCAAAAGTAGTGGCTTTTCAAAGCTTTGAATATACAGAACTAATCTAACAAAGCAAATTCTGCTGTGACCAATCCAGTATATTCAGCATGTTATCTAAAAGCATTTTTTCATATCAACTCAGATAACTCTTGGTACATGCTTAAATATCAAAGCAGTTGTAATTTAGAAGTCATTTGTGAATAAATGTGCAAGATAAGTACATATTGGATGTATATGTGTTAGAAATAAAATTATTTTGCTGAAAT