Transcript asmbl_42747

Sequence
Transcript Sequence for observation asmbl_42747 of TGE0005303:
GGGTGACCTGGCCAAGAAGAAGATCTACCCCACCATCTGGTGGCTGTTCCGGGACGGCCTTCTGCCCGAAAACACCTTCATCGTGGGCTATGCCCGCTCACGTCTCACGGTGGCCAATATCCGCCAGCAGAGCGAGCCCTTCTTCAAAGCCACCCCTGAGGAGAAGCCCAAGCTGGAGCAGTTCTTTGCCCGCAACTCCTACGTGGCTGGCCAGTACGACGACGCAGCCTCCTATCAGCGTCTCAATAGCCACATGAACACCCTCAACCAGGGGTCAAAGGCCAACCGCCTCTTCTACCTGGCCTTGCCCCCCACTGTCTATGAGGCTGTCACCAAGAACATCCGAGAGAACTGCATGAGCCAGACAGGCTGGAACCGCATCATTGTGGAGAAGCCCTTTGGGAAGGACCTGCAGAGCTCCGACCAGCTGTCCAACCACATCTCCTCCCTGTTCAGCGAGGACCAGATCTACCGCATCGACCACTACCTGGGCAAGGAGATGGTCCAGAACCTCATGGTGCTGAGGTTTGCCAACAGGATCTTCAGCCCCATCTGGAACCGGGACAACGTTGCCTGCGTCATCCTCACCTTCAAGGAGCCCTTCGGTACTGAGGGCCGTGGGGGCTACTTCGATGAATTTGGGATCATCCGGGATGTAATGCAGAACCACCTCCTGCAGATGCTGTGTCTGGTGGCCATGGAGAAGCCCGCCTCCACTGACTCGGATGATGTCCGAGATGAGAAGGTCAAGGTGTTGAAATGTATCTCAGAGGCAAAGGCGAGCAACGTGGTCCTGGGCCAGTATGTGGGGAACCCCGACGGAGAGGGCGAAGCCACCAAAGGCTACTTGGACGACCCCACAGTGCCCCGTGGGTCCACCACCGCCACCTTTGCAGCTGTGGTCCTCTATGTGGAGAACAAGAGGTGGGACGGGGTGCCCTTTATCCTGCGTTGCGGCAAAGCCCTAAATGAGCGCAAGGCCGAGGTCCGCCTGCAGTTCCGAGACGTGGCTGGCGACATCTTCCAACAGCAGTGCAAGCGCAACGAGCTCGTGATCCGCGTGCAGCCCAACGAGGCTGTGTACACCAAGATGATGACCAAGAAGCCCGGCATGTTCTTCAACCCCGAAGAGTCGGAGCTGGACCTGACCTATGGCAACAGATACAAGAATGTGAAGCTCCCTGACGCGTACGAGCGCCTCATCCTGGACGTCTTCTGTGGGAACCAGATGCATTTTGTGCGCAGTGACGAGCTCCGGGAGGCCTGGCGGATCTTCACACCGCTGCTGCATGAAATCGAGGGCAAGAAGCTCCAGCCCATCCCCTATGTTTACGGCAGCCGAGGCCCGGCGGAGGCAGACGAGCTGATGAAAAGAGTGGGCTTCCAGTACGAGGGCACCTACAAGTGGGTGAACCCCCATAAGCTCTAAGCCCCGGGCGAGCCCACCCCGTCTGTCCGCCCTCCCCACCTTCCCAGCACCTGCCCCCACGTCGAGAAAACTTCGGGACCATAGACCTCAGCCTCGCATTCCTGGCCCCGGGCCCAGCAACATTCCTCTACCACTGAGCACTTGACACTCGTGCTGTGACCGTCCCCAGCCACCACTGGCCCTGTCCGAGCCAGCTTCTGTCCACAGGGCTGAGCCCCAATGGAAGGAAAGAGAAGAATGGCCCTTCTGTCTGTCCCAGGGTCCTTGGCCTAGGACAGGAGTTAAGGGCGAGGGGGAGGACCAGGGGTGGGCTTCAGCGGGCCAGTGGCCAACGCACACACCCAGGGGCTGTGGTCAAGCCCCTCAGAACCTGGGGAAAGGGAGCAAACGTGTCCACACCAGCCTCAGCACTACTGTACATTCCTGGTCACCCACTGAAGGGACTTCTGTGCCGCCAGCAATCCCCTATGTATTGGGCCCTCTGAACGTCCCTCTGCCCCGCCCGCTGCCCCCACCAGCCCAACTCTGCACTCCATGGCCCACCCAACCCACAGGTGCCCCCCTCGCTATTAGAAAAGCAGAAGCAGCAGGTGGGACACCCCACCTCAGCTCCCTGCCATTAAATATGTAAACAGA