Transcript asmbl_42715

Sequence
Transcript Sequence for observation asmbl_42715 of TGE0005296:
CCGGAGTGAGAGAGTTTGGCGGCAGTAGCGGGGCGTGTGAGGTGTCGGTGGGAGGCTCGGAAACAAGCTCACTTCTCCCTGTTGGAAATCCAGCAACAGGATGAGTCTGCAGTGGACTGCAGTTGCCACCTTCCTCTATGCAGAGGTCTTTCTCGTGCTGCTTCTCTGCATTCCCTTCATTTCACCCAAAAGATGGCAGAAGATTTTCAAGTCCCGCCTGGTGGAGTTCGTAGTGACCCATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGCTGGTCATTGATGCTCTGCGTGAGATTCGGAAGTATGATGACGTGACAGAGAAGGTGAATCTCCAGAACAACCCTGGGGCCCTGGAACACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCCGGCTTTTCTCTGCTGCTGTCCTTCCTGCTTAGACGACTGGTGACTCTCATCTCCCAGCAGGCCACTCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCAGAGAGCGCTAGTGAGGCGGCCAAGAAGTACATGGAAGAGAATGACCAGCTGAAGAAGGAAGCTGCTGTCGGTGGCGTTGAGTTGAGTGCCAGGGAGGTGACTTTGGAGTTAGAGACCAGTAACCTGAAGGCCGATCTGAAGAAGCTGAAGGATGAGCTGGCTATAAACAAGCAAAAACTAGAGAAAGCTGAAAACGAGGCTCTGGCCATGCGGAAGCAGTCCGAGGGCCTGACCAAGGAGTACGACCGCCTGTTGGAGGAGCACACGAAGCTGCAGGTGGCAGTAGATGGTCCCACGGACAAGAAGGAGGAGTGAGGGCCCCTCCCGCCCGTGGCCTGGCCTGAGCTCGAGCTCGCCACTTCCCGAGAGCCAGGCCTCTCTGGGCACTTGCACTTCCCACCCCTCACACTGCCTACAGTTCATTGTTCTCCCAGCGCCCCCCAGAGGACCGGGCTCCCACCTACTCAGGATGCATTTGTCACCAGCTTGGCTATCCAGGAGCATGGTGGGCCCCTGGAACCCTCGTGATGGGTCTTGCTTCTTGCTGGGCGGAGCCCCTTTTTTTGTTGCACGTTGATGTTTGGGCTCCAAGTCCCCTTTTCTCTGCTCCTGCAGGAGGGTGGGCGAAGCAGGCAGAGTTTCTGTTGGGGGCAATAAAGGTTATTATGATGTG