Transcript asmbl_42276

Sequence
Transcript Sequence for observation asmbl_42276 of TGE0005280:
GGATCAGCTAAGTGCGTCAGTTGTGGACAGACGTAGGCGAGTTGTGTCCTGGTCTGCGGGGAGGTAGAGGACTCCGTCGCAGACTACGGACCTCTCTTGGGTCTCAGCTGCCAAAGATCCTGTCCGGTAGGCGCGGCCGTGGCGTCGCGAGAATCCGGCTTCCACCCGCTGTGACGCTCCTGGGAGGCGGCGAAGCGCTCGGCCCGTCGCCATTGGGCTGGCCTTGCGGAGGGCGGGGCCGGCTCCACCCGCACTTCTCGGCCTTTCCTAACTGCGGCAGATGGGAGGGGGCCAGAAGAGCCGGGGAGAGTGAGGCTGCGCAGTTCCAGAGGCGGCAGTGGGCGTTGCGGTTGCTGCGTTCTGGGCCCAGGGAAGGATCGTGTTGGGAGCCGAGTTTTAATTTTGTCTGCAAGGGACCTGGCCTAATAAGAGGCACTCTTGGCAATCTTGTTTATAACATCACCCGGGAATACTAGCCGGGCGTCATGAGTGGCTGTCGGGTATTCATCGGGAGGCTAAATCCAGCGGCCAGGGAGAAAGACGTGGAAAGGTTCTTCAAGGGGTATGGACGAATAAGAGATATCGATCTGAAGAGAGGCTTTGGTTTTGTGGAATTTGAAGATCCCAGGGATGCTGATGATGCTGTATATGAACTTGATGGAAAAGAACTTTGCAGTGAAAGGGTTACTATTGAACATGCTCGGGCTCGATCTCGAGGTGGCAGAGGTAGAGGACGCTACTCTGATCGTTTTAGTAGTCGCAGACCTCGAAATGATAGACGAAATGCTCCTCCTGTAAGAACAGAAAATCGGCTTATAGTTGAAAATTTATCTTCAAGAGTCAGCTGGCAGGATCTTAAAGATTTCATGAGACAAGCTGGGGAAGTAACCTTTGCGGATGCACATCGACCTAAATTAAATGAAGGGGTGGTTGAGTTCGCCTCTTATGGTGATTTAAAGAATGCTATTGAAAAACTTTCTGGAAAGGAAATAAATGGGAGAAAAATTAAATTAATTGAAGGCAGCAAAAGGCACAGTAGGTCACGAAGCAGGTCTCGTTCCCGGACCAGGAGTTCCTCTAGGTCTCGTAGCCGATCTCGCTCTCGGAGTCGCAAGTCTTACAGCCGGTCTAGGAGCAGGAGCCGGAGCCGGAGCAAGTCCCGTTCTGTTAGTAGGTCTCCTGCACCTGAGAAGAGCCAGAAACGTGGTTCTTCAAGTAGATCTAAGTCTCCAGCATCTGTGGATCGCCAGAGGTCCAGGTCTCGGTCCCGGTCCAGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTGAATAACTTGCCCTGGGGGCCTTTTTTAAAAAACACACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGGGGAGAAGGGGGGTGGAATTTGGAGGGGGGTTGGGTTGGGCTGGATTATCTTTGTAGATGTGGACCACCAGGGGGTTGTTGAAAACTAATTGTATTAAATTGTCTTTTGATAAGCCTTCTTCTCACATTTTTGTGAATGTCTGAAGTATATAGTTTGTGTATATTGACAGAGCTCTTTTATAACTAAAGCGAATTTAATTTTTTTGTACTAGCAAAAATTTGAACATTTTAGTGCCTGGTTATTCAAATATGTTAATTAAGAATTAGTTTAATGCCTCAATTAAACTAATTAATAGCTTTGGATACTTAAAAGAGCTCTAAATTTGCTTGTACATAGAGGCTTACTGAGTTTTCCTTGTTAGGGTCAAGGGTGTCCTCCCACCTACCCTTTAACAGCTGCTTGGCAAAGACGTTAAAGCAGCTGTTTGTTATTGATAATAAAAGATGATAAAACTGCTTTTCTGTGTCTGTCTGAAGTAAGTATGCTCTTCCTCATCTACGTTCACATTCAAAATTCCTTGTAGAGAATCCTGAAGTTTGGTTGGGTTCTTTTTTTATTTTTAAAA