Transcript asmbl_17265

Sequence
Transcript Sequence for observation asmbl_17265 of TGE0003931:
CCGGGCCGCCCGGGTTCAGTCGCCACGTGAGTGCTCCTACCCTACCTGCGACACACTCCGCGGGCAGCATGTCGGCGACAGCGGTGGCTCGAAAGCGGGGAAAGCCGGCCTCGGGGGCCCGGGCTGGTGCGGGGGCCGGCAAGCGGCGGCGAAAGGCCGACTCTGCCGGGGACAGAGGCAAGTCCAAAGGTGGCGGCAAGATGAATGAGGAGATCTCCAGCGATTCCGAGAGTGAGAGCCTAGCTCCCAGGAACATGGAGGAGGAGGAGGAGCTGGAGGAGACCGCACAGGAGAAGAAGCTGCGCTTAGCCAAGCTCTACTTGGAGCAGCTGAGGCAGCAAGAGGAGGAGAAAGTGGACGCCCGTGAGTTTGAGGAGGACCAGGTGGCGGGGCGCCTGAAGGAGGACGTGCTGGAGCAGAGGGGCAGGCTGCAGAAGTCAGTAGCAAAGGAGATCCAGGCCCCAGCCCCAGCTGACATTCGCATCTTACGGGGCCACCAGCTCTCCATCACGTGTCTGGTTATCACCCCTGACGACTTGGCCATCTTTTCTGCCGCCAAAGATTGCACCATCATTAAGTGGAGTGTGGAGAGTGGACGGAAGCTTCACGTGATCCCACGAGCCAAGAAAGGGACCGAGGGGCAGCCCCCCGGCCACAGCAGCCACGTCCTCTGCATGGCCATCTCCTCCGACGGCAAGTACCTTGCCTCGGGCGACCGCAGCAAGCTCATCCTGATTTGGGAGGCCCAGAGCTGCCAGCACCTGTACACCTTCACGGGGCACCGGGACGCCGTGTCGGGGCTGGCATTCCGCAGAGGCACCCACCAGCTCTATAGCACGTCCCACGACCGTTCCGTGAAGGTGTGGAACGTGGCAGAGAACGCCTACGTGGAGACCCTCTTCGGGCACCAGGACGCCGTGGCTGCATTGGATGCCCTGAGCCGGGAGTGCTGCGTGACGGCTGGGGGCCGGGATGGGACCGTGCGTGTGTGGAAGATCCCCGAGGAGTCGCAGCTTGTCTTCTACGGCCACCAGGGCTCCATCGACAGCATCCAGCTCATCAACGAGGAGCACATGGTGTCAGGCGCAGACGATGGCTCTGTGGCTTTGTGGGGCCTCTCCAAAAAACGGCCACTTGCTCTGCAGCGTGAAGCCCACGGGCTGCGGGGGGAGCCGGGCCTGGAGCAGCCCTTCTGGGTGTCGTCGGTGGCAGCCCTGCTCAACACAGACCTCGTGGCCACAGGCTCCCACAGCTCTTGTCTGCGGCTCTGGCAGTGCGGGGAGGGCTTCCGGCGGCTTGACCTTCTCTGCGACATCCCCCTGGTGGGCTTTATCAATAGCCTCAAGTTCTCCAGCGCTGGGGACTTCCTCGTGGCTGGGGTGGGGCAGGAGCACAGGCTGGGCCGCTGGTGGCGAATCAGAGAGGCTCGGAACTCTGTCTGCATCATCCCGCTTCGGAGGGGTCCCAGGCCCACGGCCGCGGGCTCTTAACCTTCTCATCCCCTTTATTTAAGTCCTTCCCAAGCCGCGTCCTTCCCTTTTTGTATTAAAAGC