Transcript asmbl_17207

Sequence
Transcript Sequence for observation asmbl_17207 of TGE0003927:
CCCCTCTTCCACGACATGTGCGCCGCTCAGCTGACGGCGGCCGCGGCGGCCGCGCAGGCGGCTGCGGCCCCGGGCTCCGTGTATGCCTACTCCGCGCGCCCGCTGGCGGGCGGGGAGCCCGTGAGCCTGGGCTCCCTGCGGGGCAAGGTGCTGCTCATTGAGAATGTGGCGTCGCTCTGAGGCACAACGGTCCGGGACTACACCCAGATGAACGAGCTGCAGCGGCGCCTCGGGCCCCGGGGTCTGGTGGTGCTCGGCTTCCCGTGCAACCAGTTCGGGCATCAGGAAAACACCAAAAACGAAGAGATCCTGAATTCTCTCAAGTACGTCCGACCTGGCGGCGGGTTCGAGCCCAACTTCACGCTCTTCGAGAAGTGCGACGTGAACGGCGCACAGGCGCACCCGCTCTTCACCTTCTTGAGGGAGGCTCTGCCGGCGCCCAGTGACGACACCACCGCGCTAATGACCGATCCCAAGTTCATCATCTGGTCTCCGGTATGCCGCAACGACATTGCCTGGAACTTCGAGAAGTTCCTGGTGGGCCGGGACGGCGTTCCTGTGCGCAGATACAGCCGCCGCTTCCCGACCATCGACATCGAGCCCGACATCGAAGCCCTGCTGTCCCAGGGGCCTAGCAGTGCCTAGGGCACCCCTGCTGCCTCTGCTTCTTGGCAGACACAGCGCTGCCCTCCGGGGGTTTTATCCATGATGGTGTTTCCGCTAAACCTGCAAGGAGGTACACCTGATGTCCAGGAAAATCCCCTGGGGTGGGCGCTGGGCCTGACCATCACAGCCTCTCCCTCCCACACCGCCACCCCTCTCAATAAAGTGTCCTGTCAGCAGAA