Transcript asmbl_40440

Sequence
Transcript Sequence for observation asmbl_40440 of TGE0027538:
CACAGATCTAAGGGCTCGGAGGACATTCGGCCTCTGTGAGCTGCAGCCTTTCCGAGGAGCGTCGTCTGTTCGCCATCTTAGGGAAGATGTTCTCGTCCGTGGCGCACCTGGCGCGGGCGAACCCCTTCAACGCGCCTCACCTGCAGCTGGTGTACGATGGCCTCGCAGGCCCTTGCAGCAGCCCCTCCGGACCCCCGGGGCCCCCCCGCCGCTCCCGCAACTTGGCGGCCGCCGCTGTGGAAGAGTACAGTTGCGAATTTGGCTCCATGAAGTTTTATGCACTGTGTGGCTTTGGTGGGGTCTTAAGTTGTGGTCTGACACACACTGCTGTGGTTCCTCTGGATTTAGTGAAATGCCGTATGCAGGTGGACCCCCAGAAGTACAAAGGCATATTTAATGGATTCTCAGTTACACTTAAAGAAGATGGTGTTCGAGGTTTGGCTAAAGGATGGGCTCCGACTTTCATTGGCTACTCTATGCAGGGGCTCTGCAAGTTTGGCTTTTATGAAGTCTTCAAAGTGTTGTATAGCAACATGCTTGGAGAGGAGAACACCTATCTCTGGCGCACATCACTATATTTGGCCGCCTCTGCCAGTGCTGAATTCTTTGCTGACATTGCCCTGGCTCCTATGGAAGCTGCTAAGGTTCGAATTCAAACCCAGCCAGGTTATGCCAACACTCTGAGGGATGCAGCTCCCAAAATGTATAAGGAAGAAGGCATAAACGCATTCTACAAGGGGGTTGCTCCTCTCTGGATGAGACAGATACCATACACCATGATGAAGTTCGCCTGCTTTGAACGGACTGTTGAAGCGTTGTACAAGTTTGTGGTTCCTAAGCCCCGAAGTGAATGTTCAAAGGCAGAGCAGCTGGTTGTAACATTTGTGGCAGGTTACATAGCTGGAGTCTTTTGTGCAATCGTTTCTCACCCTGCTGATTCTGTGGTGTCTGTGCTGAATAAAGAGAAAGGTAGCAGTGCTTCTCAGGTCCTCCAGAGACTTGGATTTAAAGGTAGTATTGTTTTCTCTCTAAAGAAAGAAGATTACTTTTGGGTATATTAGATTTTTCTCATTCACGTTTCACATTTCAACTAGGTGTATGGAAGGGACTCTTCGCCCGTATCATCATGATCGGCACGCTGACTGCACTGCAGTGGTTCATCTATGACTCTGTGAAGGTCTACTTCAGGCTTCCTCGCCCTCCTCCACCCGAGATGCCGGAGTCTCTGAAGAAGAAGCTTGGATTGACTCAGTAGATAGAGCAAAGCAAATATGGACTGAATCTGCTTGTTGGTCAGTGTTGAGGAAAGTGCTAAAGGAACTTTTATATATTTGACAGTGTAGGAAATTGTCTATTCCTGAAATAATTACTGTAGTGCTCTTGCCTAAGGCAAGAGTTTCAAACTTGCTGTTGAAATAAACCCAACTGTTCATGA