Transcript asmbl_40439

Sequence
Transcript Sequence for observation asmbl_40439 of TGE0005179:
CACAGATCTAAGGGCTCGGAGGACATTCGGCCTCTGTGAGCTGCAGCCTTTCCGAGGAGCGTCGTCTGTTCGCCATCTTAGGGAAGATGTTCTCGTCCGTGGCGCACCTGGCGCGGGCGAACCCCTTCAACGCGCCTCACCTGCAGCTGGTGTACGATGGCCTCGCAGGCCCTTGCAGCAGCCCCTCCGGACCCCCGGGGCCCCCCCGCCGCTCCCGCAACTTGGCGGCCGCCGCTGTGGAAGAGTACAGTTGCGAATTTGGCTCCATGAAGTTTTATGCACTGTGTGGCTTTGGTGGGGTCTTAAGTTGTGGTCTGACACACACTGCTGTGGTTCCTCTGGATTTAGTGAAATGCCGTATGCAGGTGGACCCCCAGAAGTACAAAGGCATATTTAATGGATTCTCAGTTACACTTAAAGAAGATGGTGTTCGAGGTTTGGCTAAAGGATGGGCTCCGACTTTCATTGGCTACTCTATGCAGGGGCTCTGCAAGTTTGGCTTTTATGAAGTCTTCAAAGTGTTGTATAGCAACATGCTTGGAGAGGAGAACACCTATCTCTGGCGCACATCACTATATTTGGCCGCCTCTGCCAGTGCTGAATTCTTTGCTGACATTGCCCTGGCTCCTATGGAAGCTGCTAAGGTTCGAATTCAAACCCAGCCAGGTTATGCCAACACTCTGAGGGATGCAGCTCCCAAAATGTATAAGGAAGAAGGCATAAACGCATTCTACAAGGGGGTTGCTCCTCTCTGGATGAGACAGATACCATACACCATGATGAAGTTCGCCTGCTTTGAACGGACTGTTGAAGCGTTGTACAAGTTTGTGGTTCCTAAGCCCCGAAGTGAATGTTCAAAGGCAGAGCAGCTGGTTGTAACATTTGTGGCAGGTTACATAGCTGGAGTCTTTTGTGCAATCGTTTCTCACCCTGCTGATTCTGTGGTGTCTGTGCTGAATAAAGAGAAAGGTAGCAGTGCTTCTCAGGTCCTCCAGAGACTTGGATTTAAAGGTGTATGGAAGGGACTCTTCGCCCGTATCATCATGATCGGCACGCTGACTGCACTGCAGTGGTTCATCTATGACTCTGTGAAGGTCTACTTCAGGCTTCCTCGCCCTCCTCCACCCGAGATGCCGGAGTCTCTGAAGAAGAAGCTTGGATTGACTCAGTAGATAGAGCAAAGCAAATATGGACTGAATCTGCTTGTTGGTCAGTGTTGAGGAAAGTGCTAAAGGAACTTTTATATATTTGACAGTGTAGGAAATTGTCTATTCCTGAAATAATTACTGTAGTGCTCTTGCCTAAGGCAAGAGTTTCAAACTTGCTGTTGAAATAAACCCAACTGTTCATGA