Transcript asmbl_38963

Sequence
Transcript Sequence for observation asmbl_38963 of TGE0005094:
AGGAAACCGGAAGTAGCCTCTCTCCCGGTGGCTCCTACGCGGTTAACGGATCCTCAGTGGACGCTGGCTGCGCGCCAAGGTAGTCAACGTGATACCTGCAGAGAGTGACTTCGGGGTTAAGGGTGGTGCTGGACGTCAGGAGCCAACATGGCAGCGGTGGTCGGAGTCTCCTTGAGGCGTCGATTCCCAGCCACAGCCTTTGGCGGAGCCTGCCTGCAGGCCTGCCGAGGGGCCCAGACAGCTGCAGCCACAGCTCCCCGAATCAAGAAATTTGCCATCTACCGATGGGACCCAGATAAGACTGGAGATAAACCTCATATGCAAACTTATGAAATTGATTTGAATAAATGTGGCCCCATGGTGTTGGATGCTTTAATCAAAATTAAGAATGAAATCGATTCTACCTTGACCTTCCGAAGATCATGCAGAGAAGGGATCTGTGGCTCTTGTGCAATGAACATCAATGGAGGCAACACGCTGGCTTGCACCAAAAGGATCGACACCAACCTCAACAAAGTCTCAAAAATCTACCCGCTTCCACATATGTATGTGATAAAAGATCTTGTTCCTGATTTGAGCAACTTCTATGCTCAGTACAAATCCATTGAGCCTTATTTGAAGAAGAAGGATGAATCCCAGGAAGGCAAGCAGCAGTATCTGCAGTCCATAGAAGAGCGCGAGAAACTGGATGGGCTCTACGAGTGCATCCTCTGCGCCTGCTGCAGCACCAGCTGCCCTAGCTACTGGTGGAATGGAGACAAGTATTTGGGGCCTGCGGTTCTTATGCAGGCCTATCGCTGGTTGATTGACTCCAGAGACGACTTCACAGAGGAGCGCCTGGCCAAGCTGCAGGACCCGTTCTCTCTGTATCGCTGCCACACCATCATGAACTGCACACAGACCTGCCCCAAGGGGCTGAATCCAGGGAAAGCTATTGCTGAAATCAAGAAAATGATGGCAACTTACAAGGAGAAGAAGGCGTCAGCTTAATTGTTCTCACACCAAACGTGACTTGCAACCAGCTCAGCTGGACATAACTTACATCTAATTTGGGTTCTTTCAGAGGTCTTCACTGTCCATGAATACAGCATGTATAATAAAACTTTTAAGAAATAAATAAATGTTATTCTACTTTATTAACAAAAAA