Transcript asmbl_38627

Sequence
Transcript Sequence for observation asmbl_38627 of TGE0005060:
CGGGTGATGGCGGCCCGGTGCCCCGGATGTAGGCTTGGCGAAAGCATCGCTTCTTCCCCCGCCTGCCTTGGACTCGTAGCTTGGTGAAGGCCCCTCTGTCCAGTTATGTCAAAGAGGAAAGTGACCTTCCAAGGCTTGGGAAATGAGGATGATGAAGACGAAATCAGTGTCCCCAAGAAGAAGCTGGTGGACTCTGTGGCTGGGGCAGGAGGTCCTGGGAGCCGCTTTAAAGGCAAGCACTCTTTGGACAGCGATGAGGAGGATGATGATGATGAGGGGTCCAGCAAATATGACATCCTGGCCTCAGAGGATGTAGAAGGTCAGGAAGCAGCCACACTCCCCAGCGAGGGAGGGGTACGGATCACACCCTTCAACCTACAGGAAGAGATGGAGGAAGGCCACTTTGATGCTGATGGCAACTACTTCTTGAACCGGGAGGCTCAGATACGAGACAGCTGGCTAGACAACATTGACTGGGTTAAGATCAGGGAGCGGCCACCTGATCAGCACCCACCATCAGACTCAGAGGAGGAGGACAGCCTGGGCCAGACACCAATGAGTGCCCAAGCCCTCCTGGAGGGCCTTCTGGAGCTGCTGTTGCCGAGAGAGACAGTGGCTGGGGCGCTGAGGCGCCTAGGGGCCAGAGGAGGAGGCAAAGATGGCAGCAAGGGGCCTAGGCGGCCTAGTTCCCCCCAGCGCTTGGACCGGCTCTCCGGGTTGGCTGACCAAATGGTGGCCCGGGGCAACCTTGGTGTATATCAGGAGACAAGGGAACGGTTGGCCATGCGGCTGAAGGGGTTGGGGTGCCGGACCCAGGGACACCCTGACCCCAAGCCCCCACCTTCTCTGGACATGTTTGCTGAGGAAGTGGCAGAGGGGGAGCTGGAGACCCCAACCCCTGCCCAGAGAGAAGCAGATTCGCCAGGAGATGGTTTGCTGGATGTGATGTGGGAGTATAAGTGGGAGAACACAGGGGATGCTGAGCTGTACGGGCCCTTTACCAGCACCCAGATGCAGACCTGGGTGAATGAAGGCTACTTCCCGGATGGTGTTTATTGTCGGAAGCTGGACCCCCCTGGTGGACAGTTCTACAACTCCAAACGTATTGACTTTGACCTCTACACCTGAGCCTACTGAGGGCTCACTTAGGTGGCCCCTTCTTTCCTGGACTCTGTGAAGGAGGCTCCAGCTGCCTCAGGCAGTGAGGATATTGGGGGCAACTTTTCAGTCAATTTTCCTTTCCCAATAAAAGCCTTTAGTTGTGTGTTAGGGCCTTGGCTTTGCTGATGGCCAGAAGCCAGAGACCACAGCCCCTTTGGACTTGCCTTGGTCTTATAGTGTTTCCTCATGAAGTTCCTCTTTGACAGTTCTGGTCCCTCAAACCATCTCCTGTTTACTGTTCATAAGGGCAGAGCCAGGGCTGTCAGGTGAACAGTGGCCTCCCTTTTTGGATGCAGATCACCATCTAAAAATCTCTTTACTCGTGTGGCATTCTTTGGTATCCTCTGGGCTTCCTGTTTTGCTTTTCTTCGGTCTTTGGTCTTTAGGACCTCAGAGTCTCTCCTTGCAAACAGTGCAGGGTAGAGCCCTAGCAGCGGAGATTTTAGGTCTGATGGGCTGGGGCATCTGTTGGTTTTGAGTAGGAAGCATGGTACTCACTGGCTTCTCATTTTCTCAGGCTCCTTAGGTGAAGTACAGACTCAGTATTGACTCTTGAAGGACTCCAAGGCCACCTGGGCAAACCATCCATAGAATAGGCACAGAGAGGGACAGCACCTCACTGAAGGTTACACAGTTAATCAGAGGACTGGCCCAGACCCAATGGGCTCCCTTCCCAGACCTTTCTTGGTACTAGGTCTTTTCTACCTGGCCTTGAAGCCCTGAGCTTACATTTCCTGAGCTTCCAAAGTGTGCCTGGCACTGAACTAGTGCCTTGAGGAAACTGAGATAACTGGGCTGGTCCCCTTTCAGGAGTTCACAGTCAGGAGTGTAGGTGAAGAGGGAGATAGACAAGTATAATTGTACAGTCTGGACCTACCACTACCACCCTCCCAGCCCATCAGTATGGCTTAAAGCCTCTCCTCACTTGACCAGTTTAGATTTTTCCCTCCACTTTTTCAACTTGGCTGTCCATTGGAATCTCATAGAGAGCTGTTAAATCACTCCTCAGAGACTCCGAATGAGTTGGTTTAGGTAGTGGCCTGGCAGTTGGGTTTTTAAAAAGTTCTCAGGTCTTTCTAATGTGTGGCCAGGTGGAGAGCCATTGGATCTGACTCCCATGACAAGTTATACCTGGGGAGAGGGGCTGGTTCCTGGACTCCGCCGTGGTAGAGCTGAGCATGTGTCTGGCCAGGGCTCTGGTTGATTCTGTTAGTTACAGGAGAGCTGAGCACCAGAGCCGTGGATGCATGGGAGCTCCAGGGTGGAAGGAACCAGGACTGGAACTAGGAAAGACTTGGGCGGGGATGGGGTGGGGTTACCTGATGT