Transcript asmbl_38583

Sequence
Transcript Sequence for observation asmbl_38583 of TGE0005055:
GCTGCGTTCGCTCCCTCAGTCCACTCGCCAGCCCGCTGCCCTCCACCGCTGCACCGGGCAAACCAGCCCCTCTACTCTGCCAGGCAAGGTGACCCCATGGCAAGGCGCAAGCCAGAAGGGTCCAGCTTCTACATGAGCCATCTGTCCATGGCTCTGGCCTATTCCTTTACCCCAGATGCCAGTATGCAACCCCACCCTCAGCTGGGCAACACCCAGCAACAAACAGAGTTAGGAAAGGTACAAGAGGCAGGCCTAGTTTAGGGAAGTCGGGTGTAGGGGAGAGCTGGGGACAGGAAATGATCTAAGACCTACTGGGTGTGGGGCAGAGGAGGTAGGGAACATTTGCCCTGACCTCCAGGTAAGGGGCCCTGCTCACTGGGAGACCACAGAAAGACCTAGCAAACTGGTCCTCTCCGCTCTGTTTCCTTTGCCCAGGAACTGACAGGCACCATGCCCTACCAATACCCAGCGCTGACCCCGGAGCAGAAGAAAGAGCTGTCTGACATTGCTCACCGCATTGTGGCTCCGGGCAAAGGCATCTTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACTGAGAACACCGAGGAGAACCGTCGCTTCTACCGCCAGCTGCTGCTGACTGCCGATGACCGTGTGAATCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACGCTTTATCAGAAGGCAGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGTGTGGTACCCCTGGCAGGAACAAATGGCGAGACTACCACCCAAGGATTGGATGGGCTGTCTGAGCGCTGTGCTCAGTACAAGAAGGATGGAGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAGATTGGGGAACACACTCCCTCAGCCCTTGCCATCATGGAAAATGCCAATGTTTTGGCCCGTTATGCCAGCATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCACGACCTGAAGCGCTGTCAGTATGTAACTGAAAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCATCACATCTACCTGGAAGGCACCTTGCTGAAGCCTAATATGGTCACCCCAGGCCATGCCTGCACCCAGAAATTTTCTAACGAGGAGATTGCCATGGCAACTGTCACAGCGCTGCGCCGCACAGTGCCCCCTGCTGTCACTGGGATCACCTTCTTATCTGGAGGTCAGAGTGAGGAGGAGGCATCCATCAACCTCAATGCAATCAACAAGTGCCCCCTGCTGAAGCCTTGGGCCCTGACCTTTTCCTATGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGTGGAAAGAAGGAGAACCTGAAGGCTGCCCAGGAGGAATATGTCAAGCGAGCACTGGCCAACAGCCTTGCCTGCCAAGGAAAGTACACCCCAAGTGGTCAGGCCGGGGCTGCAGCCAGCCAGTCCCTCTTCATATCTAACCATGCCTACTAAGCGGAGGTGTTCCAAGGCCGCCTCAACACTCCAGGTCCTGCCCGCTTCCACACACCTGAAGAGGGGGCCTCATCCGGGGCTCCAGGCTCCTCTTTCCCATCACTCTTACCTCCCTTGTGACATTGGTGCGTGGTGTTGTCTGTGAATGCTAACTCCATCGCCCTTTCCAGCCCACTGCCAATAAACAACTATTTAAGGGGGA