Transcript asmbl_38576

Sequence
Transcript Sequence for observation asmbl_38576 of TGE0027455:
GGTGGCGACGTCCCTGAGACCAACTACCTCTTCATGGGGGACTTTGTGGATCGTGGTTTCTACAGCGTTGAAACGTTCCTCCTGCTGCTGGCACTTAAGGTTCGCTATCCTGACCGAATCACCCTGATACGGGGCAACCATGAGAGCCGTCAGATCACCCAGGTCTACGGCTTCTATGATGAGTGCCTGCGCAAATATGGCTCAGTGACCGTGTGGCGCTACTGCACTGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATTGATGGCAAGATCTTCTGCGTGCACGGGGGCCTCTCCCCTTCCATCCAGACCCTGGACCAGATCCGGACAATTGACCGAAAGCAAGAGGTGCCTCACGACGGGCCCATGTGTGACCTGCTCTGGTCTGACCCTGAAGGCCCAAATGGGGGAGGGAAACAGGATATTTTCCTTCAAAGGGCAGTGGGCAACCAGAGAAGGCCTTGAAGACACCCTCTCCCCATCTGTACCTTCATTTGCCTCAGACACAACAGGCTGGGGCGTGAGCCCCCGTGGAGCTGGCTACCTATTTGGCAGTGATGTGGTGGCCCAGTTCAATGCAGCCAACGACATTGACATGATCTGTCGTGCCCACCAACTGGTGATGGAAGGTTACAAGTGGCACTTCAATGAGACTGTGCTCACTGTGTGGTCAGCACCCAACTACTGCTACCGCTGTGGGAACGTGGCAGCCATCTTGGAGCTAGATGAGCATCTCCAGAAAGATTTTATCATCTTCGAGGCCGCTCCTCAAGAGACACGGGGCATCCCCTCCAAGAAGCCCGTGGCTGACTACTTCCTGTGACCCCTTTGGCCCCTGTCCCCCTCCAGCCCCTCTGGCCCTTGGACCACTGTGACTGCCCTCTTCAGACAGAGGCTGGGCATTGGGGGGCTGTCCCCGGCTCTGCTCTCCCCACAAAGAGGGCACTTTGAGGGTGAGGACTTTCTCTGGAGAGGCTCAGAGCCTCAGCTCCATGCTCCTCCTCTCCCTTCTCCCCACTTGAACCATGAAGTTTCCAAGAATTTTTTTGGTTTTTTTTTTCCTTTTTTTGTTTGTTTTTAGATAAAAATTTTGAGAAAAAGAAAAAAATTCTAATAAAA