Transcript asmbl_37486

Sequence
Transcript Sequence for observation asmbl_37486 of TGE0005017:
CTCGAGGTCGACGCTACCAGGTTTCGTCGTCGCCGCCGTCGCTGCCGCTGTCGCCGTCGCTGCCGTGTTGAGAGCACCCGTCGCGGCCGTCCCAGCCGCCTTCGCCGGCCACCATGTCCGCCCAGGCACAGATGCGGGCCTTGCTGGATCAGCTAATGGGCACGGCCCGGGACGGAGATGAAACCAGACAGAGGGTGAAGTTTACAGATGACCGTGTCTGCAAGAGTCACCTTCTAGACTGCTGCCCCCATGACATCCTGGCTGGGACGCGCATGGATTTAGGAGAATGTACCAAAATCCACGACTTGGCCCTCCGAGCAGATTATGAGATTGCAAGTAAAGAAAGGGACCTGTTTTTTGAATTGGATGTGGAAGGGGGAGCTCTACCCTCAGAACATGAGGGGTAATATTTGCGTGGCTCACAAAGACCAGCAATGGATCACTTGGAGTCCTTCATTGCTGAATGTGATCGGAGAACTGAGCTTGCCAAGAAGCGGCTGGCAGAGACACAGGAGGAGATCAGCGCAGAAGTTTCTGCAAAGGCAGAAAAAGTACATGAGTTGAATGAAGAAATAGGAAAACTTCTTGCTAAAGCTGAGCAGCTGGGAGCTGAAGGAAATGTGGATGAATCCCAGAAGATTCTTATGGAAGTGGAGAAAGTCCGTGCAAAGAAAAAAGAAGCTGAGGAAGAATACAGAAATTCCATGCCTGCATCCAGTTTTCAACAGCAGAAATTGCGTGTCTGTGAAGTCTGCTCTGCTTACCTTGGCCTCCATGACAATGACCGTCGCCTTGCAGACCACTTTGGGGGCAAATTGCACTTGGGGTTCATTCAGATCCGTGAGAAACTGGATCAGTTGAGGAAAACTGTGGCTGAAAAGCAGGAGAAGAGAAATCAGGATCGCTTGAGGAGGAGAGAAGAGAGGGAGCGGGAGGAGCGGCTGAGCAGGAGGTCTGGCTCAAGAACCAGAGAGCGCAGGAGGTCACGTTCCCGGGACCGGCGTCGGAGGCGGTCAAGATCTACCTCCAGAGAGCGACGAAAGTCTTCCCGGTCCCGGTCCCGTGACAGACACCGGCGCCACCGCAGTCGTTCCCGGAGCCACAGCCGGGGCCACCGCCGGGCTTCCAGGGACCGGAGTGCGAAATACAAGTTCTCCAGAGAGCGGGCGTCGAGGGAGGAGTCCTGGGAGCGCGGGCGGAGCGAGCGGGGGGCCACCGACTGGAGGCTCGAGAGCTCCAACGGGAAGACGGCTTCGCGGAGGTCGGAGGAGAAGGAGGCTGGCGAGATCTGAACCCATGCCCAGGCACTGTAAATAGTCTGATAAACGTTCAACATGCCTGAGGTTACTCTTTATATTTGCTGAATACAACTCATCTTTTGTAGTTTAAAATTTCTATTGTTTCAGAGCTAGCTGTGAGTTTCTAGAGATGTACAGTTGCTCCTGTGTTCTGGGGTTATGTCGAGTAGGAATAAATAAATCTGACAAGACTGCCTC