Transcript asmbl_3727

Sequence
Transcript Sequence for observation asmbl_3727 of TGE0004844:
CCGCGGAGTCCGCCGAAGCTTTCGGCCGCGGCTGAGGCGGCTGAGCGGAAAAATGGTTCGGACAGTGGCGGCTGCGGCGGCAGGGGTTGTGGTGGAGGCGGAGGCTCAGGCTGCGTGAGGTCTTGCTATTTGGGGAGCTACAAAGAAAAAACAAATTAAAGGAAGGTTGGTCTTTTAAGTGGACATGGCTCAGATATCCAGCAACAATGGATTTAAGCAATGTTCGTCTTCACATCTGGAACCACCAAGACCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCAAAACTGCAAAAAGACAGGCGAGTGACTGATAATCAGAGAGGCTTCGAGTTGTCAGGCAGCACCAGACAAAAAGCACAAGTTTATAACAAACAAGATTATGATCTCATGGTGTTTCCTGAATCAGATACCCAAAAAAGAGCAGTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTGGAGAAACTATTGCTAGATGACAGTTTTGAGACAAGGAAAACACCTGTATTGCCAGTTACTCCTGCCCTGAGCCCTTCGTTTTCAGCACAGCTTTATCTTAGACCTACTACTCTTCAGAGGGGACAGTGGCCAACTGGTTTATCTGGGCCTTCAGCTTATACTTTACCTTCTATTTATCAGTCAACTTACAGCAGTAAACAGACTACATTCCAAAATGGCTTTAATCCAAGAATGCCTACTTTTCCATCCACAGAACCGATATATTTAAGTCTTCCAGGACAGTCTCCATATTTTTCATATCCTTTGTCACCTACTACATCTTTTCATCCACAAGGAAGCTTACCTGTCTATCATCCAGTAGTCAGTCCTGACATGGCAAAGCTGTTTGACAAAATAGCTAGTACATCAGAGTTTTTAAAAAATGGAAAAGCAAGGACTGATTTAGAGATAAATTCAAAAACTACAATCAGCAGCCTACAGGTATCTCCAAAGTCTGAAGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAGGTGGACAATGTGGAGGTATTAGACCATGAAGAAGAGAAAAATGTTCCAGGTTTGCTAGCAGAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCATCAGCAAGTTGTCACCTTGAAAGGAAGGTGAATGGAAAATCTCTTTCTGGGGCAGTGGTAACAAGAAGCCAGTCTTTAACTATTCGAACAACTCAGCTTACAAAAGTCCAGGGCCAAATATCTCAGAAAGACCCAAATGGGACCAGTAGTTTGCCAACTGGAAGTTCTCTTCCACAGGAATTTGAAGTACGGAATGAAGAAGTGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAACTTTCCATACACCAATCACTGCACAAATCCAGGCTATTTATTAAGTCCAGTCACAGTGCAAAGAAACATATGTGGAGAAAATGCTAGCGTGAAGGTCTCCATTGAAATTGAAGGATTTCAACTACCAGTTACTTTTACATGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTGCATGATGACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTGAAAGTTTGTGGTCAAGAGGAAGTGCTACAGAATAATCATTGCCTTGGAAGTCATGAACATATTCAAAACTGTCGAAAATGGGACACAGAGATTAAACTACGACTTTTGACCTTCAGCACAATGTGCCAAAATCTGGCCCGAACTGCAGAAGATGATGAAACACCTGTGGATTTAAACAAACACCTGCATCAAATAGAAAAACCATATAAAGAAGTCATGACAAGACACCCTGTTGAAGAACTTTTAGATTCTTATCATAATCAAGTGGAGCTGGCTCTTCAAGTAGAAAACCAGCACCGAGCAGTAGATCAAGTAATTAAAGCCGTAAGAAAAATCTGTAGTGCTTTAGACGGTGTAGAGACTCTTGCCATTACAGAATCAGTAAAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAAGTGCCGATGTGACTTCACTGTCTGGAGAAGGAGACACTAGCAAGAGTTCAACTCGGGGCTCACTGAATCCTGAAAATCCTGTTCAAGTAAGCATGGACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGGAAATTCTGGTAGGAGTCCTGCAGACTGCATCCAAAGTAACAGGAACATCAAGGAAGCGTGGACTACAGCAGAACAGCTCCAGTTTACTGTCTTTGCTGCACATGGAATTTCAAGTAACTGGGTATCAAATTATGAAAAATACTACTTGATATGTTCACTGACTCACAATGGAAAGGATCTTTTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAATGGGATGAACTAATCATTTTTCCCATCCAGATATCACAGTTGCCATTAGAATCTGTTCTTCACATTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAGCAGAGAAAGGGGCCAGAAGCTTTGGGTAAAGTTTCTTTACCTCTTTTTGATTTTAAACGGTTTTTAACATGTGGAACTAAGCTTTTATACCTTTGGACTTCATCACATACAAATCTGATTCCTGGAACAGTTCTCAAAAAAGGATATGTGATGGAAAGAATAGTGTTACAGGTTGATTTTCCTTCTCCTACATTTGATATCATTTATACCACTCCTCAAGTTGACAGAAGCATTATACAGCAGCACAACTTAGAAACATTGGAAAATGATATAAAAGGGAAACTTCTTGATATTCTTCACAAAGATTCATCGTTTGGACTTTCTAAAGAAGACAAAACCTTTTTGTGGGAGAAACGTTATTATTGCCTGAAACACCCAAATTGTCTTCCTAAAGTACTAGCAAGTGCCCCAAATTGGAAATGGGTTAATCTTGCCAAAACTTACTCATTGCTTCAGCAGTGGCCTCCATTGCACCCACTGACTGCATTAGAGCTTCTTGATTCAAAATTTGCTGATCAAGAAGTGAGGTCCCAAGCTGTGACCTGGATCGAGCCTATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTGCAGGCTTTGAAGTATGAAATTTATTTGAACAGTTCATTAGTGCGCTTCCTTCTGTCCAGGGCATTGGGAAATATACAGATAGCACACAATTTATATTGGCTCCTCAAGGATGCCCTGCATGATGCACAGTTTGGTGCCCGATATGAACATATCTTGGGTGCTCTCCTCTCAGTAGGAGGAAAAGGACTGAGAGAAGAACTCTTGAAGCAGACAAAACTTGTACAGCTTTTAGGAGTAGTAGCAGAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTCCTCCAAAGGAGTATGGAACGAGTACAGTCTTTTTTTCTAAGAAATAAATGTCGCCTGCCTCTCAATCCAAGTCTTGTGGCAAAAGAATTAAATATTAAGTCATGTTCCTTCTTCAGTTCTAATGCTGTGCCCCTAAAAGTCACAATGGTGAATGCTGATCCAATGGGTGAAGAAATTAATGTCATGTTTAAGGTTGGTGAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAAATTATGGACAAGATCTGGCTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTTTCAACTGGCAGAGATCGAGGCATGGTGGAGCTAGTTCCTGCTTCAGATACTCTCAGGAAAATCCAAGTGGAATATGGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTGAGGAAATACAATCCCTCTGAAGAGGAATATGAAAAGGCTTCTGAGAATTTTATCTATTCTTGTGCTGGATGCTGTGTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGCACAGGACACATGTTTCACATTGACTTTGGGAAGTTCTTGGGCCATGCACAGATGTTTGGTAGCTTCAGAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATCAACGGGGGTGAAAAGCCCACCATTCGTTTCCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTACAACTTGATAAGAAAGCAAACAAACCTCTTTCTTAACCTGCTTTCACTGATGATTCCTTCAGGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCCCAAACTACAGATGCAGAAGCTACAATTTTCTTTACTAGGCTGATCGAATCAAGTTTAGGAAACATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTACTGGTCTTCCTTCCAATGATGAACCCATCCTTTCATTTTCACCCAAAACTTACTCCTTTAGACAAGATGGTCGAATAAAGGAAGTCTCTGTTTTCACTTACCATAAGAAATACAACCCAGATAAACATTACATTTATGTAGTCCGAATTTTGAGGGAAGGACAGCTCGAGCCATCATTTGTGTTCCGAACATTTGACGAGTTTCAGGAACTTCACAACAAGCTCAGTATTGTTTTTCCACTTTGGAAGTTACCAGGGTTTCCTAATAGAATGGTTCTAGGAAGAACACACATAAAAGATGTAGCAGCCAAGAGAAAAGTTGAGTTAAACAGTTACTTACAAAGTTTGATGAGTGCTTCAACGGACGTAGCAGAGTGTGATCTTGTTTGTACTTTTTTTCACCCTTTACTTCGTGATGAGAAAGCTGAAGGAATAGCTAGGTCTGCAGATGCAGGTCCCTTCAGTCCTACTCCAGGCCAGATAGGAGGAGCAGTGAAATTATCTGTCTCCTACCGAAATGGTACTCTTTTCATCATGGTGATGCACATCAAAGATCTTGTTACTGAAGATGGGGCTGACCCAAATCCATATGTCAAAACCTACCTACTTCCAGATACCCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACTAGGAATCCAACATTCAATGAAATGCTTGTGTACAGTGGATATAGCAAAGAAACCCTAAGACAGAGAGAACTTCAACTAAGTGTACTCAGCGCGGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGAATAACCCTGCCTTTGAAAGATTTCAATTTGAGCAAAGAGACGGTTAGGTGGTATCAGCTGACTGCAGCAACCTATTTGTAAGCTAGTGAATTTGTGAGCTTTGGAAGCAAGAACAGTTAAAACATGTGTGTGCTTGCACACACACACACACACACACA