Transcript asmbl_16671

Sequence
Transcript Sequence for observation asmbl_16671 of TGE0003908:
CCCCGCCCGCGGGTTTCCGCGCGCCTCTTTGGCAGCTGGTCACATGGTGAGGGTGGGGGGTAAGGGGGCCGCTCTAGCCTGCGGCCTGTGTCTATGGTCTGGCCCATAGGGTCCAGCTGCCCCCGACAGAGTTCAAGTGTATGGCGCCGCAGGAACCGTCTCCGGGGCCCCGATAACGGGCCGCCCCCGCAGCTCCCGGCACGGGGTGAAGGTCTCCTTTGATCTGAGAATGGCTACCCCTCGATATGAGCCAGTGGCTGAGATTGGTGTTGGTGCGTATGGAACGGTGTACAAGGCCCGTGATCCCCACAGTGGCCACTTTGTCGCCCTCAAGAGCGTGAGAGTTCCCAATGGAGGTGCTGGAGGGGGCCTTCCCATCAGCACAGTTCGTGAGGTTGCTTTACTGAGGCGGCTGGAGGCTTTTGAGCATCCCAATGTTGTCCGGCTGATGGATGTCTGTGCCACAGCCCGAACTGACCGGGAAACCAAAGTGACCCTGGTGTTTGAGCATGTGGACCAAGACCTAAGGACGTATCTGGATAAGGCACCCCCACCAGGCTTGCCAGTGGAGACCATCAAGGATCTGATGCGCCAGTTTCTAAGAGGCCTAGATTTCCTTCATGCCAACTGCATTGTTCACCGGGACCTAAAGCCAGAGAACATTCTGGTGACAAGTGGTGGGACAGTCAAGCTGGCTGACTTTGGCCTGGCCAGAATCTACAGCTACCAGATGGCACTTACACCTGTGGTTGTTACACTCTGGTACCGTGCTCCAGAAGTTCTTCTGCAGTCTACGTATGCAACACCTGTGGACTTGTGGAGTGTTGGCTGTATCTTCGCTGAGATGTTTCGTCGAAAGTATGGGACTCAAGTATCCTGAACTATATTGAATATCCCAAATCTCTTATTCATAAACCACATCCCTACCCTGCCCATTCTTTCACTTGAGTATTACTGACCACCTTGTCCATAACCAGAAGCTCTGAAATGTCCTGGAGTTAGGAAC