Transcript asmbl_36333

Sequence
Transcript Sequence for observation asmbl_36333 of TGE0004935:
CCGCTCCCTGACCATCCCCTCCACGCCGCCCGCTGAAACCCAGCCAGAGCGCGTACTTGCACCCCGCCCCGTACTCTGACTCAGCAGTAGTCACCTTGTCCCGCCCGTGAAGCCGGAAAGTTCGCGATTCCGATAGCTTTGCGAGCGAGGTGGAGAGGGGACTTCAGAGACAGCACAGGTGATTTCACCCCTTTGCTTGTGAGTCATGGCAGCTCCCATGAAGAGCCAAGTGTGCGTGGTGACTGGTGCTTCCAGAGGTATTGGCCGTGGCATCGCCTTACAGCTCTGCCAAGCAGGTGCCACAGTTTACGTGACTGGCCGACATCTGGACACACTGCGGGCCACTGCTCAGGATGCACAATCCCGAGGGGGGCGGTGTATACCTGTGGTGTGCGATTCAAGCCAGGAGAGTGAAGTGCGAAGCCTCTTTGAGCAGGTGGCTCGAGAACAGGGGCGTCTGGATGTGCTGGTCAACAATGCCTATGCAGGGGTCCAGGCAGTCCTGAACAACATTAATAAAGCATTCTGGGAAACACCTGCCTCCTTCTGGGATGATATCAACAATGTTGGACTCAGAGGCCACTACTTGTGCTCGGTCTATGGGGCACGGCTGATGGTACCAGCTGGCCGGGGGCTCATCGTGGTCATCTCCTCCATTGGGGGGCTGAAATATCTAGCCAATGTCCCCTACGGCGTCGGTAAAGCTGCGTGCGACAGGTTGGCTGCTGACTGTGCCCTCGAGCTGCGGCGTCATGGGGTCAGCTACGTGTCTCTTTGGCCAGGATTGGTGCAAACAGAACTGCTGAAGGACTATTTGAGGAACAATGACAATGCTGAAGATTCTCTGCTTAAGCAGTTCTCGTCTGCGGAGACCACAGAAATGAGCGGAAAATGTGTGGTGGCTTTGGCAACAGACCCCAATATCTTGAGCCTGAGTGGAAAGGTACTGCCATCCTGTGACCTTGCTCGACGCTACGGCCTTCGGGATGTGGATGGCCGCCCCGTCTGGGACTATTTGTCTTTGAGCTCTGTTATCTCCCACGCCTCTAGCCTGGGCTGGCTGGCCTCCTACTTGCCTGGCTTCCTTCGTGTGCCCAAGTGGGTTATGACTCTCTACACTAGCAAGTTCTAACATTCTTGGCCTGATGTCACCACCCTGCTTGTCTTTTCAGTTGGCCTGGGTGGTTGGGCCTGTCTTAGTGGAACAAGGCAGCCTTTCCCGCCTTGCCCTTGATTCAAAGAGAAAGACTCTGCTACGTGTCCTGGGTAGGTCCTGGGGACCCTGTAGATCCTTATTTGTGCCTTGGTTTTCCTTACCCCTGCATTTTACTTTTTGCCTTCCTATCGAAAAATGCTCTGGGTACTAATAAAG