Transcript asmbl_36111

Sequence
Transcript Sequence for observation asmbl_36111 of TGE0004922:
GGAGGTGGAGGAGGAGGAGGATGGGAAGAAAGGTTCCTTGGAGACCCTGGAGGAGCTGGTCCAAGGACTAGCCTCTGAGGTGTGTGATGATTTTCTTTTCTACTGTGGAGACACACATAGCAGCTTCGTGGTCAGAACTCTGCTGCAGGTGTTAGGAGGGACTCTTCTGGAGTCTGAGAGAGCCAGACACCGTGGCTCCCAGTCACCTGAAACACAAAGGGCCCCACCTCGAGAATGTAAACCAACTGATTTTGAGGTTCCTGAATCCTTCTTGAATTGCCTTCAGGACCTGAGCTCCTGCTTTCTGAAGGATATTGCTGTGTTTATCACTGACAAGATCTCCAGCTTCTGCCTTCAAGTGGCCTTACAGATCTTACACCGCAAACTTCCCCAGTTTTGTGCCCACCTCTGTAATGCTGTGATTTGCTACCTGAGTAACCGCAATTCCTCAGCAGATGGCAGCCCCCTACTGCTATTTCTGCGGGATCAGACGAGCTCCAGACTCCTGGAGCAGGTGCTGCTGGTGTTGGAGCCTCCGAAGCTCTGGAGCCTCTTTGAGGATCACTTCCAAGGGCAGCTGCAGATCCTCGCTGCACATCCTATTGCCAACTTCCCTTTGCAGCGTTTACTGGATGCTATCACTACACCTGAGCTACTGTCCTCCGTGTTTGAGGAGCTGAGCCCTGCCTTGGAAGCTGTGCTGGCCCAGGGTCACCCAGGGGTAGTTGTTGCCCTGGTGGGGGCCTGCCGCAGAGTTGGAACCCACCAAGTCCAGGTCCTGCAGCTGTTGTTAGAGGCATTCCACTGTGCAGAGCCCTCTTCCCGGCAAGTGGCCTGCGTGCCTCTCTTTGCCACTTTGATGGCTTACGAGGTGTACTATGGACTAGTAGAGGAGGAGGGGACAGTGCCTGCAGAGCACCAGGTTGAAATGGCCACAGCCAGGGCCCTAGGGGAAGTGTCAGTCCTTGGGTCTCTACTGCTCCAGCATCTATTACATTTCTCTGCTCCTGGCCTTATACTTCGAAGTCTGGGTGCCTTGACAGGACCACAACTTCTGACTCTGGCCCAAAGCCCTTCTGGTTCCCATGTGCTTGATGCCATCCTGACCAGTCCCTCCGTGACGCACAAGCAGCGCCGCCGTGTGCTGAAGACCCTAAAGGGACAATATGTGGCTCTGGCTTGCAGTCGCCATGGCAGCCGTGTGCTAGATGTCATCTGGGGTGGAGCAGCCTTGGGGGCCCGGAAGGAAATTGCTGCTGAGCTGGGGGAGCGGAACCAGGAGCTGATAAAAGATCCTTTTGGCCACCACGTGGCTCGAAATGTGGCCCTGACTACCTTCTTGAAGCGACGAGAAGCTTGGGAACAGCAGCAGGGGGCGGTGGCCAAGCGGAGGCGGATTTTGAACTCAATACTTGAGGACTGAGGCCTTGGGATCCGGGACTGGGTGTTGATGGGGGAGGGGGAAAGGGAGTATCTATTTTATCCCCTTCCTGGTTTAAATTGGAGTCAAAAG