Transcript asmbl_3607

Sequence
Transcript Sequence for observation asmbl_3607 of TGE0004782:
TATAAATCGGCCATTTGCTTTGCTCCGCCCCAGAGCCTCCGAGTTCCAACCGGTTCCTAATCTAGTTCCGCAGTCGTCCGCCTTTTCTTCCTTTTCAACATGACAGATGCCGCTGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTGGCTGCAGCCATCTCCAAGACGGCGGTAGCACCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAAATCACCGCAGATAAGCAGTACAAGGGCATTATAGACTGCGTGGTTCGTATCCCCAAGGAGCAGGGAGTACTATCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACCCAGGCTCTCAACTTTGCCTTCAAAGATAAATACAAGCAGATCTTCCTAGGTGGTGTGGACAAGAGAACCCAGTTCTGGCGCTACTTTGCAGGCAATCTGGCATCAGGTGGTGCCGCTGGGGCCACCTCCTTGTGTTTTGTGTATCCTCTTGATTTTGCCCGTACCCGTCTAGCTGCTGATGTGGGCAAAGCTGGAGCTGAAAGGGAATTCAAAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAGGGGCCTGTACCAAGGCTTTAATGTGTCCGTGCAGGGTATTATCATCTACCGAGCTGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCAGACCCCAAGAATACTCACATCTTCATCAGCTGGATGATTGCACAGTCCGTCACTGCGGTGGCTGGGTTAACTTCCTATCCATTTGACACTGTTCGTCGTCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGATATCATGTACACGGGCACGCTCGACTGCTGGAGGAAGATTGCTCGTGATGAAGGAAGCAAAGCTTTTTTCAAGGGTGCATGGTCCAACGTTCTCAGAGGCATGGGTGGTGCTTTTGTGCTTCTCTTATATGATGAAATCAAGAAGTTCACATAAGTTATTTCCTAGTCTATTTTCCCCGTGAACAGGCATGTTGTGTTATGTAACATATCTTTGAGCATTCCTGACAGACTGTTGGCTATTTATCAGTGGCAACTATTTACTGGTTGAAAATGGGAAGCAATAATATTCATCCGACCAGTTTTCTCCTAAAGCTATTTCCATGATGATCATGATAATGATGGGACTCAATTATATTTTTTATTTCAGTCACTCCTAATAATAAATTTGAAGAAATAAAAAGTATCTGAAATACAA