Transcript asmbl_35616

Sequence
Transcript Sequence for observation asmbl_35616 of TGE0004893:
ATAAGACGCAGATTCTGGAAAGTGGCGCAAACTAGTCTTTCAAACGAGAGGCGCCAGCGTCGGATCAGGCGCTGCGTGGACAGCCGCACGGGTCCTTGGCTGGGCGGGGCTTGCTCGCGGTGGCTTGTGGCTCCTTCCTGTGCTCCTTCCCTCTTTTGCTTAGGCCGGTGGTGTTGGCAGGATGGGCAAGTGTCGCGGTCTTCGTACTGCAAGGAAGCTCCGAAGCCATCGGCGAGATCAGAAGTGGCATGATAAACAGTACAAGAAAGCCCATTTGGGCACAGCCCTGAAAGCCAACCCTTTTGGAGGCGCATCCCATGCCAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAAGCCAAACAACCAAATTCTGCCATCAGGAAGTGTGTCAGAGTCCAGCTCATCAAGAATGGCAAAAAGATCACAGCCTTTGTACCCAATGATGGTTGTTTGAATTTTATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGCAAAGGTCATGCTGTTGGTGACATTCCTGGAGTCCGCTTTAAGGTTGTCAAAGTAGCCAATGTGTCTCTCTTGGCTTTATACAAAGGCAAGAAGGAAAGACCAAGATCATAAGTTTCAATGGTGAAAACACAGTAATAATAAATTTTCATATGCCAAAAATAGGTTGTGTCTTATTTTCTTTACCACAGAGATATATGCTTTACCAATTTTAGGAGATTTGGAAAATATTTGATTCAGAGTTCTCTAGAGTAAATGCGATTCACAGTAAAGTTTATCCCCTGCATGTAATAAAATAACAGTAAATCTAGAAGAAATAAATGTACAGCATTCTTGTAAAGAGG