Transcript asmbl_33291

Sequence
Transcript Sequence for observation asmbl_33291 of TGE0004779:
GGCAGATCCAGACTTCACAGGCAGCGGCGGGCGAGGCGGTGCCTGCGAGCGCGAGGTCCGCGCTGTGCTCGCTCGGAAGATCGCTCCTCTGCATCTGGGCGCCGACGGCGGCTCGGCGGCTCGCGGAGGATCGAGAGGGCGCCGTCTGGGTCGGAGGCTTTCCCCTGGCCGCCTCGCGCCTCGTCGCCCCCGGGGAAAGCCGCGGCCCCGAAGGCAGATCCAAGGTCACCTGTAATACGGCTCTCATTGGACTGGAGTGGAAACATAAGGATTAGAGAATATTTTCATTTTTGAGAACATATGGGTGAAAGTCACGATGAATGGTCATATTTCTAATCATCCCAGTGGTTTTGGAATATATCCATCTCAAATGAATGGCTACGGAACATCATCCACCTTTTCCCAGATGGACCGAGAACACAGTTCAAAGCCAAGTGCAAAGGCCCTTTATGAACAAAGGAAGAATTATGCACGTGACAGTATCAGCAGTGTATCAAATACAACCCATTACCATGTTGAACACTTGACTACCTTTGTTCTGGATCGGAAAGATGCTATGATAACTATTGATGATGGAATAAGGAAGCTGAAATTGCTTGATGCCAAAGGCAAAGTGTGGACTCAAGACATGCTTCTTCAAGTGGATGACAGAGCCGTGAGCCTGATTGATTTAGAATCAAAGAATGAACTGGAGAATTTTCCTTTTAACACAATCCAGCACTGCCAAGCTGTGATGCATTCCTGTAACTATGATTCAATTCTTGCCCTGGTGTGCAAAGAGCCAACTCAGAATAAGCCAGATCTTCATCTTTTCCAGTGTGATGAAGTTAAGGCAAACCTAATTAGTGAAGATATTGAAAGTGCAATCAGCGACAGTAAAGGAGGGAAACAGAAGAGGCGGCCTGATGCCCTGAGGGTGATTTCCAATGCAGACCATGGAATACCGCCTCCGCCCAGAGCTCCTGCTCCCGTGCCCCCTGGGACTGTTACCCAGGTGGATGTTAGAAGTCGGGTGGCAGCCTGGTCTGCATGGGCAGCTGACCAAGGGGACTTTGAGAAACAAAGGCAGTATCATGGGCATGAAGAAACACCTGAGATGATGGCAGCCCGAATTGACAGAGATGTGCAAATCTTAAACCACATTTTGGATGACATTGAATTTTTTATCACAAAACTCCAAAAAGCAGCCGAAGCATTTTCCGAGCTGTCTAAAAGGAAGAAAACCAAGAAAGGGAAAAGGAAAGGGCCAGGAGAGGGTGTTTTAACACTGCGGGCAAAACCCCCACCTCCTGATGAATTTATTGACTGTTTCCAAAAGTTCAAACATGGATTTAACCTTCTGGCCAAATTGAAGTCTCATATCCAGAATCCCAGTGCTGCAGATTTGGTTCATTTTTTATTTACTCCATTAAATATGGTGATACAAGCAACAGGAGGCTCTGAACTAGCTAGTTCTGTACTCAGCCCCTTATTGACTAAGGACACAATTGATTTCTTAAATTATACTGTCAATACCGATGAAAGGCAGCTGTGGATGTCATTGGGCGAAACTTGGATGAAACCCAGAGCAGAGTGGCCAAAAGAACAGTTTATTCCACCATACGTTCCACGGTTCCGCAATGGTTGGGAGCCCCCAATGCTGAACTTCATGGGAGCACCGGTGGAACAAGATATTTATCAGCTGGTTGGGTCTGTGGCAGGTGCAGCAGAACAACACAGACATGAAACAAAAAGATATGCCACTGAGCAATCCAGTGTATTAGAATATGCTCCACCTCCACCTGATGGGTATGCATTCAATAACATTTACACAAGAGGGACCCATCTGGACCAAGGGGAAGCCGCTGTTGCTTTTAAGCCAGCTCCTAATCGCCATGTAGATAGAAATTATGATCCACTCATAACACAACCCAAGAAATATGCCAAATCCAAGTATGACTTTGTGGCAAGGAACGGCAGTGAGCTCTCAGTTCTAAAGGATGATATTTTAGAGATCCTCGATGATAGGAAGCAATGGTGGAAAGTTCGAAATGCAAGTGGAAACTCTGGATTTGTGCCAAATAACATTTTGGATATCGTGAGACCTACAGAATCTGGAGTAGGGCGTGCTGACCCACCGTACACACATACCATACAGAAACAAAGGATGGAGTATGGTCCAAGATCAACTGACCCTCCCTCTGCTCCGTCACCTCCTCCAACACCAGCTCCTGTTCCTGTCCCCCTTCCACCTTCTATTCCAGCACCTGTTCCTGTGTCAAAGGTCCCAGCAAATGTCACCCGTCAGAATAGCAGCTCCAGTGACAGTGGTGGCAGTACTGTGCGAGATAGCCAGAGACACAAACAACTTCCAGTGGACCGAAGGAAATCTCAGATGGAAGAAGTGCAGGATGAACTCATCCACAGGTTGACCATTGGTCGGAGCGCAGCCCAGAAGAAGTTCCATGTGCCACGGCAGAATGTGCCAGTTGTCAATATCACTTATGACTCCACTCCAGAGGATGTGAAGACGTGGTTACAGTCAAAAGGGTTCAATCCGATGACTGTCAATAGTCTTGGAGTATTAAATGGTGCACAACTTTTCTCTCTGAATAAAGATGAACTGAAGACTGTCTGCCCTGAAGGGGCAAGAGTCTTTAACCAAATCACCGTACAAAAAGCTGCATTAGAGGACATCAGTGGCAGCTCCGAGTTACAAGAAATTATGCGAAGACGACAGGAAAAAATCAGTGCTGCTGCCAGTGATTCAGGAGTGGAATCTTTTGATGAGGGAAGCAGTCACTAATTTCTTTATATGTTTGTTTTTAAACTCCATTTAAACTTTTGGCATTATTCTAACGTGCTTTGTTTTAAGAAGCCATGAAGGGAATGTCAGATTCTTATCTCTTGGTATACTTAATTTATCGCCATACAATAACAATGCAAACGTAAGTAAGCAGAGGACTTGCTCCTGGGCCCTTTATTTTTACTAAAACTGAGAATTTTTAAATAGAATTTTTTGACCTTGGGAAATATTTTGTTTACTTTACCAAGGTGAAGTTTCCTTTACTGGATTATGTCATTATAATTTCAATGTATAAGCAG