Transcript asmbl_33290

Sequence
Transcript Sequence for observation asmbl_33290 of TGE0004779:
GGCAGATCCAGACTTCACAGGCAGCGGCGGGCGAGGCGGTGCCTGCGAGCGCGAGGTCCGCGCTGTGCTCGCTCGGAAGATCGCTCCTCTGCATCTGGGCGCCGACGGCGGCTCGGCGGCTCGCGGAGGATCGAGAGGGCGCCGTCTGGGTCGGAGGCTTTCCCCTGGCCGCCTCGCGCCTCGTCGCCCCCGGGGAAAGCCGCGGCCCCGAAGGCAGATCCAAGGTCACCTGTAATACGGCTCTCATTGGACTGGAGTGGAAACATAAGGATTAGAGAATATTTTCATTTTTGAGTTTCAGATAACCCTTCTTCCACCATTTCACAATAACTCACAAATCGTAACCCTTTGGACAGCTAATTCCACAAGCAAACTTCAAGTCTTTTTCAAGAACATATGGGTGAAAGTCACGATGAATGGTCATATTTCTAATCATCCCAGTGGTTTTGGAATATATCCATCTCAAATGAATGGCTACGGAACATCATCCACCTTTTCCCAGATGGACCGAGAACACAGTTCAAAGCCAAGTGCAAAGGCCCTTTATGAACAAAGGAAGAATTATGCACGTGACAGTATCAGCAGTGTATCAAATACAACCCATTACCATGTTGAACACTTGACTACCTTTGTTCTGGATCGGAAAGATGCTATGATAACTATTGATGATGGAATAAGGAAGCTGAAATTGCTTGATGCCAAAGGCAAAGTGTGGACTCAAGACATGCTTCTTCAAGTGGATGACAGAGCCGTGAGCCTGATTGATTTAGAATCAAAGAATGAACTGGAGAATTTTCCTTTTAACACAATCCAGCACTGCCAAGCTGTGATGCATTCCTGTAACTATGATTCAATTCTTGCCCTGGTGTGCAAAGAGCCAACTCAGAATAAGCCAGATCTTCATCTTTTCCAGTGTGATGAAGTTAAGGCAAACCTAATTAGTGAAGATATTGAAAGTGCAATCAGCGACAGTAAAGGAGGGAAACAGAAGAGGCGGCCTGATGCCCTGAGGGTGATTTCCAATGCAGACCATGGAATACCGCCTCCGCCCAGAGCTCCTGCTCCCGTGCCCCCTGGGACTGTTACCCAGGTGGATGTTAGAAGTCGGGTGGCAGCCTGGTCTGCATGGGCAGCTGACCAAGGGGACTTTGAGAAACAAAGGCAGTATCATGGGCATGAAGAAACACCTGAGATGATGGCAGCCCGAATTGACAGAGATGTGCAAATCTTAAACCACATTTTGGATGACATTGAATTTTTTATCACAAAACTCCAAAAAGCAGCCGAAGCATTTTCCGAGCTGTCTAAAAGGAAGAAAACCAAGAAAGGGAAAAGGAAAGGGCCAGGAGAGGGTGTTTTAACACTGCGGGCAAAACCCCCACCTCCTGATGAATTTATTGACTGTTTCCAAAAGTTCAAACATGGATTTAACCTTCTGGCCAAATTGAAGTCTCATATCCAGAATCCCAGTGCTGCAGATTTGGTTCATTTTTTATTTACTCCATTAAATATGGTGATACAAGCAACAGGAGGCTCTGAACTAGCTAGTTCTGTACTCAGCCCCTTATTGACTAAGGACACAATTGATTTCTTAAATTATACTGTCAATACCGATGAAAGGCAGCTGTGGATGTCATTGGGCGAAACTTGGATGAAACCCAGAGCAGAGTGGCCAAAAGAACAGTTTATTCCACCATACGTTCCACGGTTCCGCAATGGTTGGGAGCCCCCAATGCTGAACTTCATGGGAGCACCGGTGGAACAAGATATTTATCAGCTGGTTGGGTCTGTGGCAGGTGCAGCAGAACAACACAGACATGAAACAAAAAGATATGCCACTGAGCAATCCAGTGTATTAGAATATGCTCCACCTCCACCTGATGGGTATGCATTCAATAACATTTACACAAGAGGGACCCATCTGGACCAAGGGGAAGCCGCTGTTGCTTTTAAGCCAGCTCCTAATCGCCATGTAGATAGAAATTATGATCCACTCATAACACAACCCAAGAAATATGCCAAATCCAAGTATGACTTTGTGGCAAGGAACGGCAGTGAGCTCTCAGTTCTAAAGGATGATATTTTAGAGATCCTCGATGATAGGAAGCAATGGTGGAAAGTTCGAAATGCAAGTGGAAACTCTGGATTTGTGCCAAATAACATTTTGGATATCGTGAGACCTACAGAATCTGGAGTAGGGCGTGCTGACCCACCGTACACACATACCATACAGAAACAAAGGATGGAGTATGGTCCAAGATCAACTGACCCTCCCTCTGCTCCGTCACCTCCTCCAACACCAGCTCCTGTTCCTGTCCCCCTTCCACCTTCTATTCCAGCACCTGTTCCTGTGTCAAAGGTCCCAGCAAATGTCACCCGTCAGAATAGCAGCTCCAGTGACAGTGGTGGCAGTACTGTGCGAGATAGCCAGAGACACAAACAACTTCCAGTGGACCGAAGGAAATCTCAGATGGAAGAAGTGCAGGATGAACTCATCCACAGGTTGACCATTGGTCGGAGCGCAGCCCAGAAGAAGTTCCATGTGCCACGGCAGAATGTGCCAGTTGTCAATATCACTTATGACTCCACTCCAGAGGATGTGAAGACGTGGTTACAGTCAAAAGGGTTCAATCCGATGACTGTCAATAGTCTTGGAGTATTAAATGGTGCACAACTTTTCTCTCTGAATAAAGATGAACTGAAGACTGTCTGCCCTGAAGGGGCAAGAGTCTTTAACCAAATCACCGTACAAAAAGCTGCATTAGAGGACATCAGTGGCAGCTCCGAGTTACAAGAAATTATGCGAAGACGACAGGAAAAAATCAGTGCTGCTGCCAGTGATTCAGGAGTGGAATCTTTTGATGAGGGAAGCAGTCACTAATTTCTTTATATGTTTGTTTTTAAACTCCATTTAAACTTTTGGCATTATTCTAACGTGCTTTGTTTTAAGAAGCCATGAAGGGAATGTCAGATTCTTATCTCTTGGTATACTTAATTTATCGCCATACAATAACAATGCAAACGTAAGTAAGCAGAGGACTTGCTCCTGGGCCCTTTATTTTTACTAAAACTGAGAATTTTTAAATAGAATTTTTTGACCTTGGGAAATATTTTGTTTACTTTACCAAGGTGAAGTTTCCTTTACTGGATTATGTCATTATAATTTCAATGTATAAGCAG